← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 3-47101597-AGTGTGTGTGTGTGTGTGTGTGT-A (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=3&pos=47101597&ref=AGTGTGTGTGTGTGTGTGTGTGT&alt=A&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "3",
"pos": 47101597,
"ref": "AGTGTGTGTGTGTGTGTGTGTGT",
"alt": "A",
"effect": "intron_variant",
"transcript": "ENST00000409792.4",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4918-64_4918-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "NM_014159.7",
"protein_id": "NP_054878.5",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2564,
"cds_start": -4,
"cds_end": null,
"cds_length": 7695,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8541,
"mane_select": "ENST00000409792.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4918-64_4918-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000409792.4",
"protein_id": "ENSP00000386759.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 2564,
"cds_start": -4,
"cds_end": null,
"cds_length": 7695,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8541,
"mane_select": "NM_014159.7",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.*641-64_*641-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000330022.11",
"protein_id": "ENSP00000332415.7",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8172,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4786-64_4786-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "NM_001349370.3",
"protein_id": "NP_001336299.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2520,
"cds_start": -4,
"cds_end": null,
"cds_length": 7563,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8525,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4786-64_4786-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000638947.2",
"protein_id": "ENSP00000491413.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 2520,
"cds_start": -4,
"cds_end": null,
"cds_length": 7563,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8302,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4819-64_4819-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000685005.1",
"protein_id": "ENSP00000509568.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2486,
"cds_start": -4,
"cds_end": null,
"cds_length": 7461,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8109,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.1731-3538_1731-3517delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000686876.1",
"protein_id": "ENSP00000509591.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1469,
"cds_start": -4,
"cds_end": null,
"cds_length": 4410,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5076,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.2797-64_2797-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000685399.1",
"protein_id": "ENSP00000508683.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1351,
"cds_start": -4,
"cds_end": null,
"cds_length": 4056,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5284,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.1933-64_1933-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000690157.1",
"protein_id": "ENSP00000509438.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1348,
"cds_start": -4,
"cds_end": null,
"cds_length": 4047,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4696,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.1854+4378_1854+4399delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000691902.1",
"protein_id": "ENSP00000510234.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1162,
"cds_start": -4,
"cds_end": null,
"cds_length": 3489,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4138,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.72-3538_72-3517delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000691544.1",
"protein_id": "ENSP00000510710.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 916,
"cds_start": -4,
"cds_end": null,
"cds_length": 2751,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3416,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.*75-64_*75-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000431180.5",
"protein_id": "ENSP00000388349.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7555,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.3817-64_3817-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000445387.5",
"protein_id": "ENSP00000411901.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7075,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.2857-64_2857-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000685505.1",
"protein_id": "ENSP00000510732.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6667,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.2797-64_2797-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000686773.1",
"protein_id": "ENSP00000510025.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6508,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.2797-64_2797-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000688290.1",
"protein_id": "ENSP00000509825.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6182,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.3082-64_3082-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000690461.1",
"protein_id": "ENSP00000509352.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6631,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.723-64_723-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000692362.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4272,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.2857-64_2857-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000692883.1",
"protein_id": "ENSP00000510674.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6748,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 5,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.2797-64_2797-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "ENST00000693321.1",
"protein_id": "ENSP00000508996.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6602,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.5107-64_5107-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "NR_146158.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8709,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4786-64_4786-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XM_047448045.1",
"protein_id": "XP_047304001.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2520,
"cds_start": -4,
"cds_end": null,
"cds_length": 7563,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8322,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4786-64_4786-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XM_024453487.2",
"protein_id": "XP_024309255.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2475,
"cds_start": -4,
"cds_end": null,
"cds_length": 7428,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 8187,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4584-3538_4584-3517delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XM_024453488.2",
"protein_id": "XP_024309256.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 2420,
"cds_start": -4,
"cds_end": null,
"cds_length": 7263,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7981,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "c.4785+1727_4785+1748delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XM_024453489.1",
"protein_id": "XP_024309257.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1633,
"cds_start": -4,
"cds_end": null,
"cds_length": 4902,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5065,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.4847-64_4847-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XR_002959514.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6233,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.4847-64_4847-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XR_007095670.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7400,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.4847-64_4847-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XR_007095671.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6244,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.4847-64_4847-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XR_007095672.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6060,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 14,
"intron_rank": 7,
"intron_rank_end": null,
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"hgvs_c": "n.4888-64_4888-43delACACACACACACACACACACAC",
"hgvs_p": null,
"transcript": "XR_007095673.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6236,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "SETD2",
"gene_hgnc_id": 18420,
"dbsnp": "rs61571386",
"frequency_reference_population": 0.00001225981,
"hom_count_reference_population": 0,
"allele_count_reference_population": 9,
"gnomad_exomes_af": 0.0000135036,
"gnomad_genomes_af": 0.00000705866,
"gnomad_exomes_ac": 8,
"gnomad_genomes_ac": 1,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.258,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -8,
"acmg_classification": "Benign",
"acmg_criteria": "BS1,BS2",
"acmg_by_gene": [
{
"score": -8,
"benign_score": 8,
"pathogenic_score": 0,
"criteria": [
"BS1",
"BS2"
],
"verdict": "Benign",
"transcript": "ENST00000409792.4",
"gene_symbol": "SETD2",
"hgnc_id": 18420,
"effects": [
"intron_variant"
],
"inheritance_mode": "AD",
"hgvs_c": "c.4918-64_4918-43delACACACACACACACACACACAC",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}