← Back to variant description 
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=3&pos=50302170&ref=GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC&alt=CGGGCCACACGGAA&genome=hg38&allGenes=true"API Response
json
{
  "variants": [
    {
      "chr": "3",
      "pos": 50302170,
      "ref": "GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC",
      "alt": "CGGGCCACACGGAA",
      "effect": "frameshift_variant,missense_variant",
      "transcript": "ENST00000395144.7",
      "consequences": [
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "NM_033159.4",
          "protein_id": "NP_149349.2",
          "transcript_support_level": null,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 920,
          "cdna_end": null,
          "cdna_length": 2031,
          "mane_select": "ENST00000395144.7",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": true,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "ENST00000395144.7",
          "protein_id": "ENSP00000378576.2",
          "transcript_support_level": 1,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 920,
          "cdna_end": null,
          "cdna_length": 2031,
          "mane_select": "NM_033159.4",
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "ENST00000266031.8",
          "protein_id": "ENSP00000266031.4",
          "transcript_support_level": 1,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 1403,
          "cdna_end": null,
          "cdna_length": 2517,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "ENST00000395143.6",
          "protein_id": "ENSP00000378575.2",
          "transcript_support_level": 1,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 405,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1218,
          "cdna_start": 919,
          "cdna_end": null,
          "cdna_length": 1522,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.205_241delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val69fs",
          "transcript": "ENST00000457214.6",
          "protein_id": "ENSP00000393358.2",
          "transcript_support_level": 1,
          "aa_start": 69,
          "aa_end": null,
          "aa_length": 253,
          "cds_start": 205,
          "cds_end": null,
          "cds_length": 762,
          "cdna_start": 562,
          "cdna_end": null,
          "cdna_length": 1084,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "MYVQ",
          "aa_alt": "SVWPE",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "start_lost",
            "splice_region_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.-26-1_10delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Met1fs",
          "transcript": "ENST00000447605.2",
          "protein_id": "ENSP00000390149.2",
          "transcript_support_level": 1,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 176,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 531,
          "cdna_start": 144,
          "cdna_end": null,
          "cdna_length": 666,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "5_prime_UTR_variant",
            "intron_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.-26-1_10delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": null,
          "transcript": "ENST00000447605.2",
          "protein_id": "ENSP00000390149.2",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 176,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 531,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 666,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "NM_153281.2",
          "protein_id": "NP_695013.1",
          "transcript_support_level": null,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 1214,
          "cdna_end": null,
          "cdna_length": 2325,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 4,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "ENST00000320295.12",
          "protein_id": "ENSP00000346068.5",
          "transcript_support_level": 2,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 1214,
          "cdna_end": null,
          "cdna_length": 2324,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "ENST00000618175.4",
          "protein_id": "ENSP00000477903.1",
          "transcript_support_level": 5,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 1111,
          "cdna_end": null,
          "cdna_length": 2225,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "NM_153282.3",
          "protein_id": "NP_695014.1",
          "transcript_support_level": null,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 405,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1218,
          "cdna_start": 920,
          "cdna_end": null,
          "cdna_length": 1941,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.205_241delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val69fs",
          "transcript": "NM_153283.3",
          "protein_id": "NP_695015.1",
          "transcript_support_level": null,
          "aa_start": 69,
          "aa_end": null,
          "aa_length": 253,
          "cds_start": 205,
          "cds_end": null,
          "cds_length": 762,
          "cdna_start": 563,
          "cdna_end": null,
          "cdna_length": 1674,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "VLEGTGKSQMYVQ",
          "aa_alt": "FRVAR?",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "missense_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs",
          "transcript": "XM_011533668.3",
          "protein_id": "XP_011531970.1",
          "transcript_support_level": null,
          "aa_start": 251,
          "aa_end": null,
          "aa_length": 435,
          "cds_start": 751,
          "cds_end": null,
          "cds_length": 1308,
          "cdna_start": 1007,
          "cdna_end": null,
          "cdna_length": 2118,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": "MYVQ",
          "aa_alt": "SVWPE",
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "frameshift_variant",
            "start_lost",
            "splice_region_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.-26-1_10delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Met1fs",
          "transcript": "NM_153285.3",
          "protein_id": "NP_695017.1",
          "transcript_support_level": null,
          "aa_start": 1,
          "aa_end": null,
          "aa_length": 176,
          "cds_start": 1,
          "cds_end": null,
          "cds_length": 531,
          "cdna_start": 145,
          "cdna_end": null,
          "cdna_length": 1256,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": false,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "n.1369_1405delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": null,
          "transcript": "NR_047690.2",
          "protein_id": null,
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 2516,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": false,
          "consequences": [
            "splice_acceptor_variant",
            "5_prime_UTR_variant",
            "intron_variant"
          ],
          "exon_rank": 2,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "HYAL1",
          "gene_hgnc_id": 5320,
          "hgvs_c": "c.-26-1_10delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": null,
          "transcript": "NM_153285.3",
          "protein_id": "NP_695017.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 176,
          "cds_start": -4,
          "cds_end": null,
          "cds_length": 531,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": 1256,
          "mane_select": null,
          "mane_plus": null,
          "biotype": null,
          "feature": null
        }
      ],
      "gene_symbol": "HYAL1",
      "gene_hgnc_id": 5320,
      "dbsnp": "rs1553713075",
      "frequency_reference_population": null,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 0,
      "gnomad_exomes_af": null,
      "gnomad_genomes_af": null,
      "gnomad_exomes_ac": null,
      "gnomad_genomes_ac": null,
      "gnomad_exomes_homalt": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 8.821,
      "phylop100way_prediction": "Pathogenic",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": 9,
      "acmg_classification": "Likely_pathogenic",
      "acmg_criteria": "PVS1,PP5",
      "acmg_by_gene": [
        {
          "score": 9,
          "benign_score": 0,
          "pathogenic_score": 9,
          "criteria": [
            "PVS1",
            "PP5"
          ],
          "verdict": "Likely_pathogenic",
          "transcript": "ENST00000395144.7",
          "gene_symbol": "HYAL1",
          "hgnc_id": 5320,
          "effects": [
            "frameshift_variant",
            "missense_variant"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG",
          "hgvs_p": "p.Val251fs"
        }
      ],
      "clinvar_disease": "Deficiency of hyaluronoglucosaminidase",
      "clinvar_classification": "Pathogenic",
      "clinvar_review_status": "no assertion criteria provided",
      "clinvar_submissions_summary": "null",
      "phenotype_combined": "Deficiency of hyaluronoglucosaminidase",
      "pathogenicity_classification_combined": "Pathogenic",
      "custom_annotations": null
    }
  ],
  "message": null
}