← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 7-107952145-TGACCAGTGGCTTT-ATTAGGAAGACACAAGCACATTAGGAAGACACAAGCACTGG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=7&pos=107952145&ref=TGACCAGTGGCTTT&alt=ATTAGGAAGACACAAGCACATTAGGAAGACACAAGCACTGG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "7",
"pos": 107952145,
"ref": "TGACCAGTGGCTTT",
"alt": "ATTAGGAAGACACAAGCACATTAGGAAGACACAAGCACTGG",
"effect": "stop_gained,missense_variant,conservative_inframe_insertion",
"transcript": "ENST00000222399.11",
"consequences": [
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "NM_002291.3",
"protein_id": "NP_002282.2",
"transcript_support_level": null,
"aa_start": 1049,
"aa_end": null,
"aa_length": 1786,
"cds_start": 3145,
"cds_end": null,
"cds_length": 5361,
"cdna_start": 3295,
"cdna_end": null,
"cdna_length": 5650,
"mane_select": "ENST00000222399.11",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": true,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "ENST00000222399.11",
"protein_id": "ENSP00000222399.6",
"transcript_support_level": 1,
"aa_start": 1049,
"aa_end": null,
"aa_length": 1786,
"cds_start": 3145,
"cds_end": null,
"cds_length": 5361,
"cdna_start": 3295,
"cdna_end": null,
"cdna_length": 5650,
"mane_select": "NM_002291.3",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 31,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "ENST00000676777.1",
"protein_id": "ENSP00000504756.1",
"transcript_support_level": null,
"aa_start": 1049,
"aa_end": null,
"aa_length": 1675,
"cds_start": 3145,
"cds_end": null,
"cds_length": 5028,
"cdna_start": 3295,
"cdna_end": null,
"cdna_length": 5231,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.2734_2747delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys912_Gln916delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "ENST00000393561.6",
"protein_id": "ENSP00000377191.2",
"transcript_support_level": 5,
"aa_start": 912,
"aa_end": null,
"aa_length": 1649,
"cds_start": 2734,
"cds_end": null,
"cds_length": 4950,
"cdna_start": 3263,
"cdna_end": null,
"cdna_length": 5618,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "ENST00000679244.1",
"protein_id": "ENSP00000504656.1",
"transcript_support_level": null,
"aa_start": 1049,
"aa_end": null,
"aa_length": 1188,
"cds_start": 3145,
"cds_end": null,
"cds_length": 3567,
"cdna_start": 3347,
"cdna_end": null,
"cdna_length": 3764,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 24,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.2734_2747delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys912_Gln916delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "ENST00000676920.1",
"protein_id": "ENSP00000503814.1",
"transcript_support_level": null,
"aa_start": 912,
"aa_end": null,
"aa_length": 1051,
"cds_start": 2734,
"cds_end": null,
"cds_length": 3156,
"cdna_start": 3263,
"cdna_end": null,
"cdna_length": 3680,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 28,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "XM_047420359.1",
"protein_id": "XP_047276315.1",
"transcript_support_level": null,
"aa_start": 1049,
"aa_end": null,
"aa_length": 1399,
"cds_start": 3145,
"cds_end": null,
"cds_length": 4200,
"cdna_start": 3295,
"cdna_end": null,
"cdna_length": 4509,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "KATGQ",
"aa_alt": "PVLVSS*CACVFLM",
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet",
"transcript": "XM_047420360.1",
"protein_id": "XP_047276316.1",
"transcript_support_level": null,
"aa_start": 1049,
"aa_end": null,
"aa_length": 1188,
"cds_start": 3145,
"cds_end": null,
"cds_length": 3567,
"cdna_start": 3295,
"cdna_end": null,
"cdna_length": 3717,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000676574.1",
"protein_id": "ENSP00000503081.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5818,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.*2781_*2794delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677101.1",
"protein_id": "ENSP00000503156.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5556,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.2913_2926delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677144.1",
"protein_id": "ENSP00000503049.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5470,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.4369_4382delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677485.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 6737,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677588.1",
"protein_id": "ENSP00000502938.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5332,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 27,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3334_3347delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677652.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4436,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.2734_2747delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677801.1",
"protein_id": "ENSP00000503438.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5699,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 21,
"exon_rank_end": null,
"exon_count": 22,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3311_3324delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677994.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3624,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 29,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3334_3347delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678232.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4865,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 23,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3287_3300delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678266.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4136,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 21,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.*2781_*2794delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678346.1",
"protein_id": "ENSP00000504349.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4124,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.2734_2747delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678698.1",
"protein_id": "ENSP00000503198.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5765,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.*1727_*1740delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678704.1",
"protein_id": "ENSP00000504589.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5706,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 35,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678892.1",
"protein_id": "ENSP00000504841.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5797,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.3334_3347delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000679173.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5466,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.2734_2747delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000679200.1",
"protein_id": "ENSP00000503498.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5713,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 22,
"exon_rank_end": null,
"exon_count": 33,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.*2781_*2794delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677101.1",
"protein_id": "ENSP00000503156.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5556,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 21,
"exon_rank_end": null,
"exon_count": 25,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.*2781_*2794delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678346.1",
"protein_id": "ENSP00000504349.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4124,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": false,
"consequences": [
"3_prime_UTR_variant"
],
"exon_rank": 23,
"exon_rank_end": null,
"exon_count": 34,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "n.*1727_*1740delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000678704.1",
"protein_id": "ENSP00000504589.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5706,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": false,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 32,
"intron_rank": 22,
"intron_rank_end": null,
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"hgvs_c": "c.3079+1372_3079+1385delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": null,
"transcript": "ENST00000677793.1",
"protein_id": "ENSP00000504020.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 1682,
"cds_start": -4,
"cds_end": null,
"cds_length": 5049,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5390,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "LAMB1",
"gene_hgnc_id": 6486,
"dbsnp": "rs387907343",
"frequency_reference_population": null,
"hom_count_reference_population": 0,
"allele_count_reference_population": 0,
"gnomad_exomes_af": null,
"gnomad_genomes_af": null,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": null,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 7.957,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 9,
"acmg_classification": "Likely_pathogenic",
"acmg_criteria": "PVS1,PP5",
"acmg_by_gene": [
{
"score": 9,
"benign_score": 0,
"pathogenic_score": 9,
"criteria": [
"PVS1",
"PP5"
],
"verdict": "Likely_pathogenic",
"transcript": "ENST00000222399.11",
"gene_symbol": "LAMB1",
"hgnc_id": 6486,
"effects": [
"stop_gained",
"missense_variant",
"conservative_inframe_insertion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.3145_3158delAAAGCCACTGGTCAinsCCAGTGCTTGTGTCTTCCTAATGTGCTTGTGTCTTCCTAAT",
"hgvs_p": "p.Lys1049_Gln1053delinsProValLeuValSerSerTerCysAlaCysValPheLeuMet"
}
],
"clinvar_disease": "Cobblestone lissencephaly without muscular or ocular involvement",
"clinvar_classification": "Pathogenic",
"clinvar_review_status": "no assertion criteria provided",
"clinvar_submissions_summary": "null",
"phenotype_combined": "Cobblestone lissencephaly without muscular or ocular involvement",
"pathogenicity_classification_combined": "Pathogenic",
"custom_annotations": null
}
],
"message": null
}