← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 7-246502-G-GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=7&pos=246502&ref=G&alt=GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "7",
"pos": 246502,
"ref": "G",
"alt": "GGACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGC",
"effect": "intron_variant",
"transcript": "ENST00000313766.6",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"hgvs_c": "n.510_511insGTGAGCCCTTCCTTCCTCCCTCCATCCGCGACAG",
"hgvs_p": null,
"transcript": "ENST00000515795.1",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2177,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"hgvs_c": "c.953_956+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG",
"hgvs_p": null,
"transcript": "NM_020223.4",
"protein_id": "NP_064608.2",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 584,
"cds_start": -4,
"cds_end": null,
"cds_length": 1755,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3176,
"mane_select": "ENST00000313766.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"hgvs_c": "c.864-11_864-10insGTGAGCCCTTCCTTCCTCCCTCCATCCGCGACAG",
"hgvs_p": null,
"transcript": "ENST00000313766.6",
"protein_id": "ENSP00000322323.5",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 584,
"cds_start": -4,
"cds_end": null,
"cds_length": 1755,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3176,
"mane_select": "NM_020223.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"hgvs_c": "n.1503_1506+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG",
"hgvs_p": null,
"transcript": "XR_001744837.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2221,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"hgvs_c": "n.1582_1585+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG",
"hgvs_p": null,
"transcript": "XR_007060116.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2300,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"hgvs_c": "n.1503_1506+30dupACAGGTGAGCCCTTCCTTCCTCCCTCCATCCGCG",
"hgvs_p": null,
"transcript": "XR_007060117.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 1723,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "FAM20C",
"gene_hgnc_id": 22140,
"dbsnp": "rs771282640",
"frequency_reference_population": 0.2829193,
"hom_count_reference_population": 72792,
"allele_count_reference_population": 379427,
"gnomad_exomes_af": 0.272762,
"gnomad_genomes_af": 0.396859,
"gnomad_exomes_ac": 335863,
"gnomad_genomes_ac": 43564,
"gnomad_exomes_homalt": 66117,
"gnomad_genomes_homalt": 6675,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 8.672,
"phylop100way_prediction": "Pathogenic",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -15,
"acmg_classification": "Benign",
"acmg_criteria": "PP3,BP6_Very_Strong,BA1",
"acmg_by_gene": [
{
"score": -15,
"benign_score": 16,
"pathogenic_score": 1,
"criteria": [
"PP3",
"BP6_Very_Strong",
"BA1"
],
"verdict": "Benign",
"transcript": "ENST00000313766.6",
"gene_symbol": "FAM20C",
"hgnc_id": 22140,
"effects": [
"intron_variant"
],
"inheritance_mode": "AR",
"hgvs_c": "c.864-11_864-10insGTGAGCCCTTCCTTCCTCCCTCCATCCGCGACAG",
"hgvs_p": null
}
],
"clinvar_disease": "FAM20C-related disorder,Lethal osteosclerotic bone dysplasia,not provided,not specified",
"clinvar_classification": "Benign",
"clinvar_review_status": "criteria provided, multiple submitters, no conflicts",
"clinvar_submissions_summary": "B:5",
"phenotype_combined": "not specified|not provided|Lethal osteosclerotic bone dysplasia|FAM20C-related disorder",
"pathogenicity_classification_combined": "Benign",
"custom_annotations": null
}
],
"message": null
}