← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 8-11808709-G-GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=8&pos=11808709&ref=G&alt=GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "8",
"pos": 11808709,
"ref": "G",
"alt": "GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC",
"effect": "conservative_inframe_insertion",
"transcript": "NM_001287750.2",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_004462.5",
"protein_id": "NP_004453.3",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000220584.9",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_004462.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000220584.9",
"protein_id": "ENSP00000220584.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_004462.5",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000220584.9"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "n.100-919_100-918insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000529464.5",
"protein_id": "ENSP00000434770.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000529464.5"
},
{
"aa_ref": "C",
"aa_alt": "HSHSHSHSHSHSHSC",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.231_232insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": "p.Ser77_Cys78insHisSerHisSerHisSerHisSerHisSerHisSerHisSer",
"transcript": "NM_001287750.2",
"protein_id": "NP_001274679.1",
"transcript_support_level": null,
"aa_start": 78,
"aa_end": null,
"aa_length": 476,
"cds_start": 232,
"cds_end": null,
"cds_length": 1431,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287750.2"
},
{
"aa_ref": "C",
"aa_alt": "HSHSHSHSHSHSHSC",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"conservative_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.231_232insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": "p.Ser77_Cys78insHisSerHisSerHisSerHisSerHisSerHisSerHisSer",
"transcript": "ENST00000525954.5",
"protein_id": "ENSP00000491537.1",
"transcript_support_level": 2,
"aa_start": 78,
"aa_end": null,
"aa_length": 476,
"cds_start": 232,
"cds_end": null,
"cds_length": 1431,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000525954.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938356.1",
"protein_id": "ENSP00000608415.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 418,
"cds_start": null,
"cds_end": null,
"cds_length": 1257,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938356.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287742.2",
"protein_id": "NP_001274671.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287742.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287743.2",
"protein_id": "NP_001274672.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287743.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000530337.6",
"protein_id": "ENSP00000431852.2",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000530337.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000615631.5",
"protein_id": "ENSP00000481481.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000615631.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000866105.1",
"protein_id": "ENSP00000536164.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000866105.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 11,
"intron_rank": 4,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000866106.1",
"protein_id": "ENSP00000536165.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000866106.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000941571.1",
"protein_id": "ENSP00000611630.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 417,
"cds_start": null,
"cds_end": null,
"cds_length": 1254,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000941571.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000525900.5",
"protein_id": "ENSP00000434714.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 410,
"cds_start": null,
"cds_end": null,
"cds_length": 1233,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000525900.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938349.1",
"protein_id": "ENSP00000608408.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 410,
"cds_start": null,
"cds_end": null,
"cds_length": 1233,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938349.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938361.1",
"protein_id": "ENSP00000608420.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 402,
"cds_start": null,
"cds_end": null,
"cds_length": 1209,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938361.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000443614.6",
"protein_id": "ENSP00000390367.2",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 374,
"cds_start": null,
"cds_end": null,
"cds_length": 1125,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000443614.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938352.1",
"protein_id": "ENSP00000608411.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 367,
"cds_start": null,
"cds_end": null,
"cds_length": 1104,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938352.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000866107.1",
"protein_id": "ENSP00000536166.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 358,
"cds_start": null,
"cds_end": null,
"cds_length": 1077,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000866107.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938346.1",
"protein_id": "ENSP00000608405.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 358,
"cds_start": null,
"cds_end": null,
"cds_length": 1077,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938346.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 3,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000941570.1",
"protein_id": "ENSP00000611629.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 358,
"cds_start": null,
"cds_end": null,
"cds_length": 1077,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000941570.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287744.2",
"protein_id": "NP_001274673.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287744.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287745.2",
"protein_id": "NP_001274674.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287745.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287747.2",
"protein_id": "NP_001274676.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287747.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287748.2",
"protein_id": "NP_001274677.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287748.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287749.2",
"protein_id": "NP_001274678.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287749.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000528812.5",
"protein_id": "ENSP00000431749.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000528812.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000530664.5",
"protein_id": "ENSP00000432331.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000530664.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000622850.3",
"protein_id": "ENSP00000484122.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000622850.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000866109.1",
"protein_id": "ENSP00000536168.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 353,
"cds_start": null,
"cds_end": null,
"cds_length": 1062,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000866109.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938353.1",
"protein_id": "ENSP00000608412.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 351,
"cds_start": null,
"cds_end": null,
"cds_length": 1056,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938353.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.49-46_49-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000866110.1",
"protein_id": "ENSP00000536169.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 341,
"cds_start": null,
"cds_end": null,
"cds_length": 1026,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000866110.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938347.1",
"protein_id": "ENSP00000608406.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 325,
"cds_start": null,
"cds_end": null,
"cds_length": 978,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938347.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000866108.1",
"protein_id": "ENSP00000536167.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 323,
"cds_start": null,
"cds_end": null,
"cds_length": 972,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000866108.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938365.1",
"protein_id": "ENSP00000608424.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 318,
"cds_start": null,
"cds_end": null,
"cds_length": 957,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938365.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.78+5838_78+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938357.1",
"protein_id": "ENSP00000608416.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 316,
"cds_start": null,
"cds_end": null,
"cds_length": 951,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938357.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938351.1",
"protein_id": "ENSP00000608410.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 315,
"cds_start": null,
"cds_end": null,
"cds_length": 948,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938351.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938354.1",
"protein_id": "ENSP00000608413.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 298,
"cds_start": null,
"cds_end": null,
"cds_length": 897,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938354.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938364.1",
"protein_id": "ENSP00000608423.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 280,
"cds_start": null,
"cds_end": null,
"cds_length": 843,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938364.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938355.1",
"protein_id": "ENSP00000608414.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 264,
"cds_start": null,
"cds_end": null,
"cds_length": 795,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938355.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.64+5838_64+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "NM_001287756.2",
"protein_id": "NP_001274685.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 250,
"cds_start": null,
"cds_end": null,
"cds_length": 753,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001287756.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.78+5838_78+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938348.1",
"protein_id": "ENSP00000608407.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 231,
"cds_start": null,
"cds_end": null,
"cds_length": 696,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938348.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.48+5868_48+5869insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938350.1",
"protein_id": "ENSP00000608409.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 221,
"cds_start": null,
"cds_end": null,
"cds_length": 666,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938350.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938362.1",
"protein_id": "ENSP00000608421.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 216,
"cds_start": null,
"cds_end": null,
"cds_length": 651,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938362.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938358.1",
"protein_id": "ENSP00000608417.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 200,
"cds_start": null,
"cds_end": null,
"cds_length": 603,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938358.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938359.1",
"protein_id": "ENSP00000608418.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 157,
"cds_start": null,
"cds_end": null,
"cds_length": 474,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938359.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.78+5838_78+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938363.1",
"protein_id": "ENSP00000608422.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 150,
"cds_start": null,
"cds_end": null,
"cds_length": 453,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938363.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000938360.1",
"protein_id": "ENSP00000608419.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 106,
"cds_start": null,
"cds_end": null,
"cds_length": 321,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000938360.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "n.259_260insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000531733.1",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000531733.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "n.268+5838_268+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000446331.6",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000446331.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 6,
"intron_rank": 1,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "n.100-1044_100-1043insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000525283.5",
"protein_id": "ENSP00000433985.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000525283.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": 2,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "n.*159-46_*159-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": null,
"transcript": "ENST00000525607.5",
"protein_id": "ENSP00000432551.1",
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000525607.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"hgvs_c": "n.-178_-177insTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC",
"hgvs_p": null,
"transcript": "ENST00000532266.5",
"protein_id": "ENSP00000435900.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000532266.5"
}
],
"gene_symbol": "FDFT1",
"gene_hgnc_id": 3629,
"dbsnp": "rs71711801",
"frequency_reference_population": 0.000079203426,
"hom_count_reference_population": 3,
"allele_count_reference_population": 120,
"gnomad_exomes_af": 0.0000790599,
"gnomad_genomes_af": 0.0000805185,
"gnomad_exomes_ac": 108,
"gnomad_genomes_ac": 12,
"gnomad_exomes_homalt": 3,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.258,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -5,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP3,BS2",
"acmg_by_gene": [
{
"score": -5,
"benign_score": 5,
"pathogenic_score": 0,
"criteria": [
"BP3",
"BS2"
],
"verdict": "Likely_benign",
"transcript": "NM_001287750.2",
"gene_symbol": "FDFT1",
"hgnc_id": 3629,
"effects": [
"conservative_inframe_insertion"
],
"inheritance_mode": "AR",
"hgvs_c": "c.231_232insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
"hgvs_p": "p.Ser77_Cys78insHisSerHisSerHisSerHisSerHisSerHisSerHisSer"
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}