← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 8-11808709-G-GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=8&pos=11808709&ref=G&alt=GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC&genome=hg38&allGenes=true"

API Response

json
{
  "variants": [
    {
      "chr": "8",
      "pos": 11808709,
      "ref": "G",
      "alt": "GTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC",
      "effect": "conservative_inframe_insertion",
      "transcript": "NM_001287750.2",
      "consequences": [
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_004462.5",
          "protein_id": "NP_004453.3",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "ENST00000220584.9",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_004462.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": true,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000220584.9",
          "protein_id": "ENSP00000220584.4",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": "NM_004462.5",
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000220584.9"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "n.100-919_100-918insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000529464.5",
          "protein_id": "ENSP00000434770.1",
          "transcript_support_level": 1,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "nonsense_mediated_decay",
          "feature": "ENST00000529464.5"
        },
        {
          "aa_ref": "C",
          "aa_alt": "HSHSHSHSHSHSHSHSHSHSC",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.231_232insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": "p.Ser77_Cys78insHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSer",
          "transcript": "NM_001287750.2",
          "protein_id": "NP_001274679.1",
          "transcript_support_level": null,
          "aa_start": 78,
          "aa_end": null,
          "aa_length": 476,
          "cds_start": 232,
          "cds_end": null,
          "cds_length": 1431,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287750.2"
        },
        {
          "aa_ref": "C",
          "aa_alt": "HSHSHSHSHSHSHSHSHSHSC",
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "conservative_inframe_insertion"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.231_232insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": "p.Ser77_Cys78insHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSer",
          "transcript": "ENST00000525954.5",
          "protein_id": "ENSP00000491537.1",
          "transcript_support_level": 2,
          "aa_start": 78,
          "aa_end": null,
          "aa_length": 476,
          "cds_start": 232,
          "cds_end": null,
          "cds_length": 1431,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000525954.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938356.1",
          "protein_id": "ENSP00000608415.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 418,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1257,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938356.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287742.2",
          "protein_id": "NP_001274671.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287742.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287743.2",
          "protein_id": "NP_001274672.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287743.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000530337.6",
          "protein_id": "ENSP00000431852.2",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000530337.6"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000615631.5",
          "protein_id": "ENSP00000481481.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000615631.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000866105.1",
          "protein_id": "ENSP00000536164.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000866105.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 11,
          "intron_rank": 4,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000866106.1",
          "protein_id": "ENSP00000536165.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000866106.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 10,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000941571.1",
          "protein_id": "ENSP00000611630.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 417,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1254,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000941571.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000525900.5",
          "protein_id": "ENSP00000434714.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 410,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1233,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000525900.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938349.1",
          "protein_id": "ENSP00000608408.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 410,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1233,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938349.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938361.1",
          "protein_id": "ENSP00000608420.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 402,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1209,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938361.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000443614.6",
          "protein_id": "ENSP00000390367.2",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 374,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1125,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000443614.6"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938352.1",
          "protein_id": "ENSP00000608411.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 367,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1104,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938352.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000866107.1",
          "protein_id": "ENSP00000536166.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 358,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1077,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000866107.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938346.1",
          "protein_id": "ENSP00000608405.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 358,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1077,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938346.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 3,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000941570.1",
          "protein_id": "ENSP00000611629.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 358,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1077,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000941570.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287744.2",
          "protein_id": "NP_001274673.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287744.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287745.2",
          "protein_id": "NP_001274674.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287745.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287747.2",
          "protein_id": "NP_001274676.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287747.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287748.2",
          "protein_id": "NP_001274677.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287748.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287749.2",
          "protein_id": "NP_001274678.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287749.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000528812.5",
          "protein_id": "ENSP00000431749.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000528812.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000530664.5",
          "protein_id": "ENSP00000432331.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000530664.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 8,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.-93-46_-93-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000622850.3",
          "protein_id": "ENSP00000484122.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000622850.3"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000866109.1",
          "protein_id": "ENSP00000536168.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 353,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1062,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000866109.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938353.1",
          "protein_id": "ENSP00000608412.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 351,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1056,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938353.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.49-46_49-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000866110.1",
          "protein_id": "ENSP00000536169.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 341,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 1026,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000866110.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938347.1",
          "protein_id": "ENSP00000608406.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 325,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 978,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938347.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000866108.1",
          "protein_id": "ENSP00000536167.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 323,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 972,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000866108.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.79-46_79-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938365.1",
          "protein_id": "ENSP00000608424.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 318,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 957,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938365.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.78+5838_78+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938357.1",
          "protein_id": "ENSP00000608416.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 316,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 951,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938357.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938351.1",
          "protein_id": "ENSP00000608410.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 315,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 948,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938351.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 7,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938354.1",
          "protein_id": "ENSP00000608413.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 298,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 897,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938354.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938364.1",
          "protein_id": "ENSP00000608423.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 280,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 843,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938364.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938355.1",
          "protein_id": "ENSP00000608414.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 264,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 795,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938355.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.64+5838_64+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "NM_001287756.2",
          "protein_id": "NP_001274685.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 250,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 753,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "NM_001287756.2"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.78+5838_78+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938348.1",
          "protein_id": "ENSP00000608407.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 231,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 696,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938348.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.48+5868_48+5869insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938350.1",
          "protein_id": "ENSP00000608409.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 221,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 666,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938350.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938362.1",
          "protein_id": "ENSP00000608421.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 216,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 651,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938362.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 4,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.100-46_100-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938358.1",
          "protein_id": "ENSP00000608417.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 200,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 603,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938358.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938359.1",
          "protein_id": "ENSP00000608418.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 157,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 474,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938359.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 3,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.78+5838_78+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938363.1",
          "protein_id": "ENSP00000608422.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 150,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 453,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938363.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": true,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "c.99+5817_99+5818insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000938360.1",
          "protein_id": "ENSP00000608419.1",
          "transcript_support_level": null,
          "aa_start": null,
          "aa_end": null,
          "aa_length": 106,
          "cds_start": null,
          "cds_end": null,
          "cds_length": 321,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "protein_coding",
          "feature": "ENST00000938360.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_rank": 1,
          "exon_rank_end": null,
          "exon_count": 2,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "n.259_260insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000531733.1",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "retained_intron",
          "feature": "ENST00000531733.1"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "n.268+5838_268+5839insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000446331.6",
          "protein_id": null,
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "pseudogene",
          "feature": "ENST00000446331.6"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 6,
          "intron_rank": 1,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "n.100-1044_100-1043insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000525283.5",
          "protein_id": "ENSP00000433985.1",
          "transcript_support_level": 3,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "nonsense_mediated_decay",
          "feature": "ENST00000525283.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "intron_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 9,
          "intron_rank": 2,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "n.*159-46_*159-45insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": null,
          "transcript": "ENST00000525607.5",
          "protein_id": "ENSP00000432551.1",
          "transcript_support_level": 2,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "nonsense_mediated_decay",
          "feature": "ENST00000525607.5"
        },
        {
          "aa_ref": null,
          "aa_alt": null,
          "canonical": false,
          "protein_coding": false,
          "strand": true,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_rank": null,
          "exon_rank_end": null,
          "exon_count": 5,
          "intron_rank": null,
          "intron_rank_end": null,
          "gene_symbol": "FDFT1",
          "gene_hgnc_id": 3629,
          "hgvs_c": "n.-178_-177insTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCAC",
          "hgvs_p": null,
          "transcript": "ENST00000532266.5",
          "protein_id": "ENSP00000435900.1",
          "transcript_support_level": 5,
          "aa_start": null,
          "aa_end": null,
          "aa_length": null,
          "cds_start": null,
          "cds_end": null,
          "cds_length": null,
          "cdna_start": null,
          "cdna_end": null,
          "cdna_length": null,
          "mane_select": null,
          "mane_plus": null,
          "biotype": "nonsense_mediated_decay",
          "feature": "ENST00000532266.5"
        }
      ],
      "gene_symbol": "FDFT1",
      "gene_hgnc_id": 3629,
      "dbsnp": "rs71711801",
      "frequency_reference_population": 0.000026839512,
      "hom_count_reference_population": 0,
      "allele_count_reference_population": 4,
      "gnomad_exomes_af": 0.0000212291,
      "gnomad_genomes_af": 0.0000268395,
      "gnomad_exomes_ac": 29,
      "gnomad_genomes_ac": 4,
      "gnomad_exomes_homalt": 3,
      "gnomad_genomes_homalt": 0,
      "gnomad_mito_homoplasmic": null,
      "gnomad_mito_heteroplasmic": null,
      "computational_score_selected": null,
      "computational_prediction_selected": null,
      "computational_source_selected": null,
      "splice_score_selected": null,
      "splice_prediction_selected": null,
      "splice_source_selected": null,
      "revel_score": null,
      "revel_prediction": null,
      "alphamissense_score": null,
      "alphamissense_prediction": null,
      "bayesdelnoaf_score": null,
      "bayesdelnoaf_prediction": null,
      "phylop100way_score": 0.258,
      "phylop100way_prediction": "Benign",
      "spliceai_max_score": null,
      "spliceai_max_prediction": null,
      "dbscsnv_ada_score": null,
      "dbscsnv_ada_prediction": null,
      "apogee2_score": null,
      "apogee2_prediction": null,
      "mitotip_score": null,
      "mitotip_prediction": null,
      "acmg_score": -1,
      "acmg_classification": "Likely_benign",
      "acmg_criteria": "BP3",
      "acmg_by_gene": [
        {
          "score": -1,
          "benign_score": 1,
          "pathogenic_score": 0,
          "criteria": [
            "BP3"
          ],
          "verdict": "Likely_benign",
          "transcript": "NM_001287750.2",
          "gene_symbol": "FDFT1",
          "hgnc_id": 3629,
          "effects": [
            "conservative_inframe_insertion"
          ],
          "inheritance_mode": "AR",
          "hgvs_c": "c.231_232insCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC",
          "hgvs_p": "p.Ser77_Cys78insHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSerHisSer"
        }
      ],
      "clinvar_disease": "FDFT1-related disorder",
      "clinvar_classification": "Uncertain significance",
      "clinvar_review_status": "criteria provided, single submitter",
      "clinvar_submissions_summary": "US:1",
      "phenotype_combined": "FDFT1-related disorder",
      "pathogenicity_classification_combined": "Uncertain significance",
      "custom_annotations": null
    }
  ],
  "message": null
}