← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 9-137161203-T-TGCGCGGGGCAGGGCGCGGG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=9&pos=137161203&ref=T&alt=TGCGCGGGGCAGGGCGCGGG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "9",
"pos": 137161203,
"ref": "T",
"alt": "TGCGCGGGGCAGGGCGCGGG",
"effect": "splice_region_variant,intron_variant",
"transcript": "ENST00000371561.8",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+29_1340-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_007327.4",
"protein_id": "NP_015566.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 938,
"cds_start": -4,
"cds_end": null,
"cds_length": 2817,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4379,
"mane_select": "ENST00000371561.8",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+6_1339+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371561.8",
"protein_id": "ENSP00000360616.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 938,
"cds_start": -4,
"cds_end": null,
"cds_length": 2817,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4379,
"mane_select": "NM_007327.4",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+6_1402+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371553.8",
"protein_id": "ENSP00000360608.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 943,
"cds_start": -4,
"cds_end": null,
"cds_length": 2832,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+6_1402+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371560.5",
"protein_id": "ENSP00000360615.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 906,
"cds_start": -4,
"cds_end": null,
"cds_length": 2721,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4775,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+6_1339+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371559.8",
"protein_id": "ENSP00000360614.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 885,
"cds_start": -4,
"cds_end": null,
"cds_length": 2658,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3577,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "n.*314+6_*314+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000350902.9",
"protein_id": "ENSP00000316915.9",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4465,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "n.1416+6_1416+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000471122.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4184,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+29_1403-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_001437330.1",
"protein_id": "NP_001424259.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 959,
"cds_start": -4,
"cds_end": null,
"cds_length": 2880,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4442,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+6_1402+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371546.8",
"protein_id": "ENSP00000360601.4",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 959,
"cds_start": -4,
"cds_end": null,
"cds_length": 2880,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4114,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 21,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+29_1403-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_001185090.2",
"protein_id": "NP_001172019.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 943,
"cds_start": -4,
"cds_end": null,
"cds_length": 2832,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4079,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+29_1403-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_001437331.1",
"protein_id": "NP_001424260.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 922,
"cds_start": -4,
"cds_end": null,
"cds_length": 2769,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4331,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+6_1402+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371555.8",
"protein_id": "ENSP00000360610.4",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 922,
"cds_start": -4,
"cds_end": null,
"cds_length": 2769,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4003,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+29_1403-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_001185091.2",
"protein_id": "NP_001172020.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 906,
"cds_start": -4,
"cds_end": null,
"cds_length": 2721,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3968,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+29_1340-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_021569.4",
"protein_id": "NP_067544.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 901,
"cds_start": -4,
"cds_end": null,
"cds_length": 2706,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4268,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+6_1339+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000371550.8",
"protein_id": "ENSP00000360605.4",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 901,
"cds_start": -4,
"cds_end": null,
"cds_length": 2706,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3940,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 19,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+29_1340-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "NM_000832.7",
"protein_id": "NP_000823.4",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 885,
"cds_start": -4,
"cds_end": null,
"cds_length": 2658,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3905,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"splice_region_variant",
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": 6,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "n.769+6_769+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null,
"transcript": "ENST00000675295.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2174,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 9,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1339+29_1340-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "XM_005266071.4",
"protein_id": "XP_005266128.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 922,
"cds_start": -4,
"cds_end": null,
"cds_length": 2769,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4016,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"intron_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 20,
"intron_rank": 10,
"intron_rank_end": null,
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"hgvs_c": "c.1402+29_1403-45dupCGGGGCAGGGCGCGGGGCG",
"hgvs_p": null,
"transcript": "XM_011518583.3",
"protein_id": "XP_011516885.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 892,
"cds_start": -4,
"cds_end": null,
"cds_length": 2679,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4031,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC105376328",
"gene_hgnc_id": null,
"hgvs_c": "n.-162_-144dupCCCGCGCCCTGCCCCGCGC",
"hgvs_p": null,
"transcript": "XR_007061875.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 5320,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC105376328",
"gene_hgnc_id": null,
"hgvs_c": "n.-162_-144dupCCCGCGCCCTGCCCCGCGC",
"hgvs_p": null,
"transcript": "XR_007061876.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4907,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC105376328",
"gene_hgnc_id": null,
"hgvs_c": "n.-162_-144dupCCCGCGCCCTGCCCCGCGC",
"hgvs_p": null,
"transcript": "XR_007061877.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4910,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "LOC105376328",
"gene_hgnc_id": null,
"hgvs_c": "n.-162_-144dupCCCGCGCCCTGCCCCGCGC",
"hgvs_p": null,
"transcript": "XR_007061878.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4914,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "GRIN1",
"gene_hgnc_id": 4584,
"dbsnp": "rs761110882",
"frequency_reference_population": 0.00015549739,
"hom_count_reference_population": 1,
"allele_count_reference_population": 250,
"gnomad_exomes_af": 0.000129779,
"gnomad_genomes_af": 0.000402837,
"gnomad_exomes_ac": 189,
"gnomad_genomes_ac": 61,
"gnomad_exomes_homalt": 1,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.311,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": -5,
"acmg_classification": "Likely_benign",
"acmg_criteria": "BP6,BS1",
"acmg_by_gene": [
{
"score": -5,
"benign_score": 5,
"pathogenic_score": 0,
"criteria": [
"BP6",
"BS1"
],
"verdict": "Likely_benign",
"transcript": "ENST00000371561.8",
"gene_symbol": "GRIN1",
"hgnc_id": 4584,
"effects": [
"splice_region_variant",
"intron_variant"
],
"inheritance_mode": "AD,AR",
"hgvs_c": "c.1339+6_1339+7insGCGCGGGGCAGGGCGCGGG",
"hgvs_p": null
},
{
"score": -1,
"benign_score": 1,
"pathogenic_score": 0,
"criteria": [
"BP6"
],
"verdict": "Likely_benign",
"transcript": "XR_007061875.1",
"gene_symbol": "LOC105376328",
"hgnc_id": null,
"effects": [
"upstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.-162_-144dupCCCGCGCCCTGCCCCGCGC",
"hgvs_p": null
}
],
"clinvar_disease": " autosomal dominant,Neurodevelopmental disorder with or without hyperkinetic movements and seizures,not specified",
"clinvar_classification": "Conflicting classifications of pathogenicity",
"clinvar_review_status": "criteria provided, conflicting classifications",
"clinvar_submissions_summary": "US:1 B:1",
"phenotype_combined": "not specified|Neurodevelopmental disorder with or without hyperkinetic movements and seizures, autosomal dominant",
"pathogenicity_classification_combined": "Conflicting classifications of pathogenicity",
"custom_annotations": null
}
],
"message": null
}