← Back to variant description

GeneBe API Showcase

This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.

API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.

Documentation & Advanced Usage

Complete API documentation:docs.genebe.net/docs/api/overview/

Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/

Python client for pandas:pypi.org/project/genebe/

Java CLI for VCF files:github.com/pstawinski/genebe-cli

All tools documented at:docs.genebe.net

API Request Examples for Variant: 9-2621884-T-TCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC (hg38)

Bash / cURL Example

bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=9&pos=2621884&ref=T&alt=TCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC&genome=hg38&allGenes=true"

API Response

json
{
  "message": null,
  "variants": [
    {
      "acmg_by_gene": [
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "5_prime_UTR_variant"
          ],
          "gene_symbol": "VLDLR",
          "hgnc_id": 12698,
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "inheritance_mode": "AR",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "NM_003383.5",
          "verdict": "Uncertain_significance"
        },
        {
          "benign_score": 0,
          "criteria": [],
          "effects": [
            "intron_variant"
          ],
          "gene_symbol": "VLDLR-AS1",
          "hgnc_id": 49621,
          "hgvs_c": "n.274+215_274+216insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "inheritance_mode": "",
          "pathogenic_score": 0,
          "score": 0,
          "transcript": "ENST00000453601.5",
          "verdict": "Uncertain_significance"
        }
      ],
      "acmg_classification": "Uncertain_significance",
      "acmg_criteria": "",
      "acmg_score": 0,
      "allele_count_reference_population": 1,
      "alphamissense_prediction": null,
      "alphamissense_score": null,
      "alt": "TCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC",
      "apogee2_prediction": null,
      "apogee2_score": null,
      "bayesdelnoaf_prediction": null,
      "bayesdelnoaf_score": null,
      "chr": "9",
      "clinvar_classification": "",
      "clinvar_disease": "",
      "clinvar_review_status": "",
      "clinvar_submissions_summary": "",
      "computational_prediction_selected": null,
      "computational_score_selected": null,
      "computational_source_selected": null,
      "consequences": [
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 873,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 9213,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2622,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 19,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "NM_003383.5",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "ENST00000382100.8",
          "protein_coding": true,
          "protein_id": "NP_003374.3",
          "strand": true,
          "transcript": "NM_003383.5",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 873,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": true,
          "cdna_end": null,
          "cdna_length": 9213,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2622,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 19,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000382100.8",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": "NM_003383.5",
          "protein_coding": true,
          "protein_id": "ENSP00000371532.2",
          "strand": true,
          "transcript": "ENST00000382100.8",
          "transcript_support_level": 1
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 887,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000453601.5",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.274+215_274+216insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "ENST00000453601.5",
          "transcript_support_level": 1
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 872,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5222,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2619,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 19,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000947327.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000617386.1",
          "strand": true,
          "transcript": "ENST00000947327.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 861,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5437,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2586,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000916502.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000586561.1",
          "strand": true,
          "transcript": "ENST00000916502.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 845,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 9129,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2538,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "NM_001018056.3",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001018066.1",
          "strand": true,
          "transcript": "NM_001018056.3",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 833,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3439,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2502,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000947330.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000617389.1",
          "strand": true,
          "transcript": "ENST00000947330.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 832,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 9090,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2499,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "NM_001322225.2",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001309154.1",
          "strand": true,
          "transcript": "NM_001322225.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 832,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5185,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2499,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000680746.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000505030.1",
          "strand": true,
          "transcript": "ENST00000680746.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 820,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3585,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2463,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000947329.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000617388.1",
          "strand": true,
          "transcript": "ENST00000947329.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 804,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 9006,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2415,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 17,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "NM_001322226.2",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "NP_001309155.1",
          "strand": true,
          "transcript": "NM_001322226.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 772,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5176,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2319,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 17,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000916501.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000586560.1",
          "strand": true,
          "transcript": "ENST00000916501.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 498,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 2011,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 1497,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 11,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "XM_047423848.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "XP_047279804.1",
          "strand": true,
          "transcript": "XM_047423848.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 107,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 517,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 325,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000382096.6",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-70-207_-70-206insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000371528.2",
          "strand": true,
          "transcript": "ENST00000382096.6",
          "transcript_support_level": 5
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "nonsense_mediated_decay",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 4386,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000680891.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "n.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": "ENSP00000505167.1",
          "strand": true,
          "transcript": "ENST00000680891.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "nonsense_mediated_decay",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5087,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "non_coding_transcript_exon_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000681644.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "n.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": "ENSP00000505180.1",
          "strand": true,
          "transcript": "ENST00000681644.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "nonsense_mediated_decay",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 4386,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000680891.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "n.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": "ENSP00000505167.1",
          "strand": true,
          "transcript": "ENST00000680891.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "nonsense_mediated_decay",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5087,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "5_prime_UTR_variant"
          ],
          "exon_count": 18,
          "exon_rank": 1,
          "exon_rank_end": null,
          "feature": "ENST00000681644.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "n.-277_-276insCCCCATGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": "ENSP00000505180.1",
          "strand": true,
          "transcript": "ENST00000681644.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 4163,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 10,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000657742.1",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.274+215_274+216insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "ENST00000657742.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 4519,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 11,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000671040.1",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.358+215_358+216insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "ENST00000671040.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 887,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "intron_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "NR_015375.2",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.274+215_274+216insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": 1,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": false,
          "transcript": "NR_015375.2",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 847,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5050,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2544,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 18,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000947328.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000617387.1",
          "strand": true,
          "transcript": "ENST00000947328.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 845,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 5723,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2538,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 18,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000681306.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000506072.1",
          "strand": true,
          "transcript": "ENST00000681306.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": 804,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "protein_coding",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 4666,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": 2415,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 17,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000681618.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "c.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": true,
          "protein_id": "ENSP00000505773.1",
          "strand": true,
          "transcript": "ENST00000681618.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "nonsense_mediated_decay",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3068,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 18,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000680243.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "n.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": "ENSP00000505911.1",
          "strand": true,
          "transcript": "ENST00000680243.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "nonsense_mediated_decay",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 3239,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 18,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000681806.1",
          "gene_hgnc_id": 12698,
          "gene_symbol": "VLDLR",
          "hgvs_c": "n.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCATGCCTC",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": "ENSP00000505282.1",
          "strand": true,
          "transcript": "ENST00000681806.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 697,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000742987.1",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.-13_-12insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000742987.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 946,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 4,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000742988.1",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.-15_-14insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000742988.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 729,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 5,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000742989.1",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.-34_-33insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000742989.1",
          "transcript_support_level": null
        },
        {
          "aa_alt": null,
          "aa_end": null,
          "aa_length": null,
          "aa_ref": null,
          "aa_start": null,
          "biotype": "pseudogene",
          "canonical": false,
          "cdna_end": null,
          "cdna_length": 263,
          "cdna_start": null,
          "cds_end": null,
          "cds_length": null,
          "cds_start": null,
          "consequences": [
            "upstream_gene_variant"
          ],
          "exon_count": 2,
          "exon_rank": null,
          "exon_rank_end": null,
          "feature": "ENST00000743010.1",
          "gene_hgnc_id": 49621,
          "gene_symbol": "VLDLR-AS1",
          "hgvs_c": "n.-34_-33insGAGGCATGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
          "hgvs_p": null,
          "intron_rank": null,
          "intron_rank_end": null,
          "mane_plus": null,
          "mane_select": null,
          "protein_coding": false,
          "protein_id": null,
          "strand": true,
          "transcript": "ENST00000743010.1",
          "transcript_support_level": null
        }
      ],
      "custom_annotations": null,
      "dbscsnv_ada_prediction": null,
      "dbscsnv_ada_score": null,
      "dbsnp": "rs539873248",
      "effect": "5_prime_UTR_variant",
      "frequency_reference_population": 0.0000022406352,
      "gene_hgnc_id": 12698,
      "gene_symbol": "VLDLR",
      "gnomad_exomes_ac": 1,
      "gnomad_exomes_af": 0.00000224064,
      "gnomad_exomes_homalt": 0,
      "gnomad_genomes_ac": null,
      "gnomad_genomes_af": null,
      "gnomad_genomes_homalt": null,
      "gnomad_mito_heteroplasmic": null,
      "gnomad_mito_homoplasmic": null,
      "hom_count_reference_population": 0,
      "mitotip_prediction": null,
      "mitotip_score": null,
      "pathogenicity_classification_combined": null,
      "phenotype_combined": null,
      "phylop100way_prediction": "Benign",
      "phylop100way_score": -0.211,
      "pos": 2621884,
      "ref": "T",
      "revel_prediction": null,
      "revel_score": null,
      "splice_prediction_selected": null,
      "splice_score_selected": null,
      "splice_source_selected": null,
      "spliceai_max_prediction": null,
      "spliceai_max_score": null,
      "transcript": "NM_003383.5"
    }
  ]
}
For research and educational, non-commercial use only. Not for clinical or diagnostic use. GeneBe does not provide medical advice. Data use for AI modeling is prohibited: if used, the cost is $0.001 per byte of downloaded uncompressed data.