← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: 9-2621884-T-TCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=9&pos=2621884&ref=T&alt=TCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC&genome=hg38&allGenes=true"API Response
json
{
"message": null,
"variants": [
{
"acmg_by_gene": [
{
"benign_score": 0,
"criteria": [],
"effects": [
"5_prime_UTR_variant"
],
"gene_symbol": "VLDLR",
"hgnc_id": 12698,
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"inheritance_mode": "AR",
"pathogenic_score": 0,
"score": 0,
"transcript": "NM_003383.5",
"verdict": "Uncertain_significance"
},
{
"benign_score": 0,
"criteria": [],
"effects": [
"intron_variant"
],
"gene_symbol": "VLDLR-AS1",
"hgnc_id": 49621,
"hgvs_c": "n.274+215_274+216insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"inheritance_mode": "",
"pathogenic_score": 0,
"score": 0,
"transcript": "ENST00000453601.5",
"verdict": "Uncertain_significance"
}
],
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_score": 0,
"allele_count_reference_population": 1,
"alphamissense_prediction": null,
"alphamissense_score": null,
"alt": "TCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC",
"apogee2_prediction": null,
"apogee2_score": null,
"bayesdelnoaf_prediction": null,
"bayesdelnoaf_score": null,
"chr": "9",
"clinvar_classification": "",
"clinvar_disease": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"computational_prediction_selected": null,
"computational_score_selected": null,
"computational_source_selected": null,
"consequences": [
{
"aa_alt": null,
"aa_end": null,
"aa_length": 873,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 9213,
"cdna_start": null,
"cds_end": null,
"cds_length": 2622,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 19,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_003383.5",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": "ENST00000382100.8",
"protein_coding": true,
"protein_id": "NP_003374.3",
"strand": true,
"transcript": "NM_003383.5",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 873,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": true,
"cdna_end": null,
"cdna_length": 9213,
"cdna_start": null,
"cds_end": null,
"cds_length": 2622,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 19,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000382100.8",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": "NM_003383.5",
"protein_coding": true,
"protein_id": "ENSP00000371532.2",
"strand": true,
"transcript": "ENST00000382100.8",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 887,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000453601.5",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.274+215_274+216insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": 1,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000453601.5",
"transcript_support_level": 1
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 872,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 5222,
"cdna_start": null,
"cds_end": null,
"cds_length": 2619,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 19,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000947327.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000617386.1",
"strand": true,
"transcript": "ENST00000947327.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 861,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 5437,
"cdna_start": null,
"cds_end": null,
"cds_length": 2586,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000916502.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000586561.1",
"strand": true,
"transcript": "ENST00000916502.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 845,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 9129,
"cdna_start": null,
"cds_end": null,
"cds_length": 2538,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_001018056.3",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "NP_001018066.1",
"strand": true,
"transcript": "NM_001018056.3",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 833,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 3439,
"cdna_start": null,
"cds_end": null,
"cds_length": 2502,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000947330.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000617389.1",
"strand": true,
"transcript": "ENST00000947330.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 832,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 9090,
"cdna_start": null,
"cds_end": null,
"cds_length": 2499,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_001322225.2",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "NP_001309154.1",
"strand": true,
"transcript": "NM_001322225.2",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 832,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 5185,
"cdna_start": null,
"cds_end": null,
"cds_length": 2499,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000680746.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000505030.1",
"strand": true,
"transcript": "ENST00000680746.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 820,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 3585,
"cdna_start": null,
"cds_end": null,
"cds_length": 2463,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000947329.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000617388.1",
"strand": true,
"transcript": "ENST00000947329.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 804,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 9006,
"cdna_start": null,
"cds_end": null,
"cds_length": 2415,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 17,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "NM_001322226.2",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "NP_001309155.1",
"strand": true,
"transcript": "NM_001322226.2",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 772,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 5176,
"cdna_start": null,
"cds_end": null,
"cds_length": 2319,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 17,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000916501.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000586560.1",
"strand": true,
"transcript": "ENST00000916501.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 498,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 2011,
"cdna_start": null,
"cds_end": null,
"cds_length": 1497,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 11,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "XM_047423848.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "XP_047279804.1",
"strand": true,
"transcript": "XM_047423848.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 107,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 517,
"cdna_start": null,
"cds_end": null,
"cds_length": 325,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000382096.6",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-70-207_-70-206insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": 1,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000371528.2",
"strand": true,
"transcript": "ENST00000382096.6",
"transcript_support_level": 5
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 4386,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000680891.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "n.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000505167.1",
"strand": true,
"transcript": "ENST00000680891.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 5087,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000681644.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "n.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000505180.1",
"strand": true,
"transcript": "ENST00000681644.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 4386,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000680891.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "n.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000505167.1",
"strand": true,
"transcript": "ENST00000680891.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 5087,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"5_prime_UTR_variant"
],
"exon_count": 18,
"exon_rank": 1,
"exon_rank_end": null,
"feature": "ENST00000681644.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "n.-277_-276insCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTCCCCTCCTCT",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000505180.1",
"strand": true,
"transcript": "ENST00000681644.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 4163,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 10,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000657742.1",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.274+215_274+216insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": 1,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000657742.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 4519,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 11,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000671040.1",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.358+215_358+216insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": 1,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "ENST00000671040.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 887,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"intron_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "NR_015375.2",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.274+215_274+216insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": 1,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": false,
"transcript": "NR_015375.2",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 847,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 5050,
"cdna_start": null,
"cds_end": null,
"cds_length": 2544,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 18,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000947328.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000617387.1",
"strand": true,
"transcript": "ENST00000947328.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 845,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 5723,
"cdna_start": null,
"cds_end": null,
"cds_length": 2538,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 18,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000681306.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000506072.1",
"strand": true,
"transcript": "ENST00000681306.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": 804,
"aa_ref": null,
"aa_start": null,
"biotype": "protein_coding",
"canonical": false,
"cdna_end": null,
"cdna_length": 4666,
"cdna_start": null,
"cds_end": null,
"cds_length": 2415,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 17,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000681618.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "c.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": true,
"protein_id": "ENSP00000505773.1",
"strand": true,
"transcript": "ENST00000681618.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 3068,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 18,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000680243.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "n.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000505911.1",
"strand": true,
"transcript": "ENST00000680243.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "nonsense_mediated_decay",
"canonical": false,
"cdna_end": null,
"cdna_length": 3239,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 18,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000681806.1",
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"hgvs_c": "n.-306_-305insCCCTCCTCTCCCCTTGCCTCCCCTCCTCTCCCCTTGCCTC",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": "ENSP00000505282.1",
"strand": true,
"transcript": "ENST00000681806.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 697,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000742987.1",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.-13_-12insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000742987.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 946,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 4,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000742988.1",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.-15_-14insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000742988.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 729,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 5,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000742989.1",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.-34_-33insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000742989.1",
"transcript_support_level": null
},
{
"aa_alt": null,
"aa_end": null,
"aa_length": null,
"aa_ref": null,
"aa_start": null,
"biotype": "pseudogene",
"canonical": false,
"cdna_end": null,
"cdna_length": 263,
"cdna_start": null,
"cds_end": null,
"cds_length": null,
"cds_start": null,
"consequences": [
"upstream_gene_variant"
],
"exon_count": 2,
"exon_rank": null,
"exon_rank_end": null,
"feature": "ENST00000743010.1",
"gene_hgnc_id": 49621,
"gene_symbol": "VLDLR-AS1",
"hgvs_c": "n.-34_-33insGAGGCAAGGGGAGAGGAGGGGAGGCAAGGGGAGAGGAGGG",
"hgvs_p": null,
"intron_rank": null,
"intron_rank_end": null,
"mane_plus": null,
"mane_select": null,
"protein_coding": false,
"protein_id": null,
"strand": true,
"transcript": "ENST00000743010.1",
"transcript_support_level": null
}
],
"custom_annotations": null,
"dbscsnv_ada_prediction": null,
"dbscsnv_ada_score": null,
"dbsnp": "rs539873248",
"effect": "5_prime_UTR_variant",
"frequency_reference_population": 0.0000022406352,
"gene_hgnc_id": 12698,
"gene_symbol": "VLDLR",
"gnomad_exomes_ac": 1,
"gnomad_exomes_af": 0.00000224064,
"gnomad_exomes_homalt": 0,
"gnomad_genomes_ac": null,
"gnomad_genomes_af": null,
"gnomad_genomes_homalt": null,
"gnomad_mito_heteroplasmic": null,
"gnomad_mito_homoplasmic": null,
"hom_count_reference_population": 0,
"mitotip_prediction": null,
"mitotip_score": null,
"pathogenicity_classification_combined": null,
"phenotype_combined": null,
"phylop100way_prediction": "Benign",
"phylop100way_score": -0.211,
"pos": 2621884,
"ref": "T",
"revel_prediction": null,
"revel_score": null,
"splice_prediction_selected": null,
"splice_score_selected": null,
"splice_source_selected": null,
"spliceai_max_prediction": null,
"spliceai_max_score": null,
"transcript": "NM_003383.5"
}
]
}