← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: X-147912049-C-CGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=X&pos=147912049&ref=C&alt=CGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG&genome=hg38&allGenes=true"API Response
json
{
"variants": [
{
"chr": "X",
"pos": 147912049,
"ref": "C",
"alt": "CGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"effect": "5_prime_UTR_variant",
"transcript": "NM_002024.6",
"consequences": [
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NM_002024.6",
"protein_id": "NP_002015.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 632,
"cds_start": null,
"cds_end": null,
"cds_length": 1899,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "ENST00000370475.9",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_002024.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000370475.9",
"protein_id": "ENSP00000359506.5",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 632,
"cds_start": null,
"cds_end": null,
"cds_length": 1899,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": "NM_002024.6",
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000370475.9"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000218200.12",
"protein_id": "ENSP00000218200.8",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 611,
"cds_start": null,
"cds_end": null,
"cds_length": 1836,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000218200.12"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000439526.6",
"protein_id": "ENSP00000395923.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 592,
"cds_start": null,
"cds_end": null,
"cds_length": 1779,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000439526.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000440235.6",
"protein_id": "ENSP00000413764.3",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 586,
"cds_start": null,
"cds_end": null,
"cds_length": 1761,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000440235.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000621453.5",
"protein_id": "ENSP00000479528.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 548,
"cds_start": null,
"cds_end": null,
"cds_length": 1647,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000621453.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000334557.10",
"protein_id": "ENSP00000355115.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 297,
"cds_start": null,
"cds_end": null,
"cds_length": 894,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000334557.10"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943060.1",
"protein_id": "ENSP00000613119.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 633,
"cds_start": null,
"cds_end": null,
"cds_length": 1902,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943060.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943057.1",
"protein_id": "ENSP00000613116.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 629,
"cds_start": null,
"cds_end": null,
"cds_length": 1890,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943057.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000857074.1",
"protein_id": "ENSP00000527133.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 620,
"cds_start": null,
"cds_end": null,
"cds_length": 1863,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000857074.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943058.1",
"protein_id": "ENSP00000613117.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 612,
"cds_start": null,
"cds_end": null,
"cds_length": 1839,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943058.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NM_001185076.2",
"protein_id": "NP_001172005.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 611,
"cds_start": null,
"cds_end": null,
"cds_length": 1836,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001185076.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000928839.1",
"protein_id": "ENSP00000598898.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 607,
"cds_start": null,
"cds_end": null,
"cds_length": 1824,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000928839.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000857075.1",
"protein_id": "ENSP00000527134.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 603,
"cds_start": null,
"cds_end": null,
"cds_length": 1812,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000857075.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943061.1",
"protein_id": "ENSP00000613120.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 600,
"cds_start": null,
"cds_end": null,
"cds_length": 1803,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943061.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000691111.1",
"protein_id": "ENSP00000509552.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 599,
"cds_start": null,
"cds_end": null,
"cds_length": 1800,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000691111.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000687593.1",
"protein_id": "ENSP00000509270.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 594,
"cds_start": null,
"cds_end": null,
"cds_length": 1785,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000687593.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943062.1",
"protein_id": "ENSP00000613121.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 589,
"cds_start": null,
"cds_end": null,
"cds_length": 1770,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943062.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943059.1",
"protein_id": "ENSP00000613118.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 587,
"cds_start": null,
"cds_end": null,
"cds_length": 1764,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943059.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NM_001185082.2",
"protein_id": "NP_001172011.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 586,
"cds_start": null,
"cds_end": null,
"cds_length": 1761,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001185082.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000370477.5",
"protein_id": "ENSP00000359508.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 582,
"cds_start": null,
"cds_end": null,
"cds_length": 1749,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000370477.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000691214.1",
"protein_id": "ENSP00000510362.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 569,
"cds_start": null,
"cds_end": null,
"cds_length": 1710,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000691214.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000495717.6",
"protein_id": "ENSP00000481474.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 561,
"cds_start": null,
"cds_end": null,
"cds_length": 1686,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000495717.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000685491.1",
"protein_id": "ENSP00000509963.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 559,
"cds_start": null,
"cds_end": null,
"cds_length": 1680,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000685491.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000943063.1",
"protein_id": "ENSP00000613122.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 549,
"cds_start": null,
"cds_end": null,
"cds_length": 1650,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943063.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NM_001185075.2",
"protein_id": "NP_001172004.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 537,
"cds_start": null,
"cds_end": null,
"cds_length": 1614,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001185075.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000370471.7",
"protein_id": "ENSP00000359502.3",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 537,
"cds_start": null,
"cds_end": null,
"cds_length": 1614,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000370471.7"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000616382.5",
"protein_id": "ENSP00000481058.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 536,
"cds_start": null,
"cds_end": null,
"cds_length": 1611,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000616382.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NM_001185081.2",
"protein_id": "NP_001172010.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 516,
"cds_start": null,
"cds_end": null,
"cds_length": 1551,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "NM_001185081.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-457_-456insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000692108.1",
"protein_id": "ENSP00000508963.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 509,
"cds_start": null,
"cds_end": null,
"cds_length": 1530,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000692108.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000857076.1",
"protein_id": "ENSP00000527135.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 188,
"cds_start": null,
"cds_end": null,
"cds_length": 567,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000857076.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.1_2insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000492846.2",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000492846.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000616614.4",
"protein_id": "ENSP00000480513.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000616614.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.1_2insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000689570.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000689570.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.1_2insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000691793.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000691793.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.162_163insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NR_033699.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_033699.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.162_163insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "NR_033700.2",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_033700.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 12,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null,
"transcript": "ENST00000616614.4",
"protein_id": "ENSP00000480513.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000616614.4"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000439526.6",
"protein_id": "ENSP00000395923.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 592,
"cds_start": null,
"cds_end": null,
"cds_length": 1779,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000439526.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000621453.5",
"protein_id": "ENSP00000479528.2",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 548,
"cds_start": null,
"cds_end": null,
"cds_length": 1647,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000621453.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 10,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000334557.10",
"protein_id": "ENSP00000355115.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": 297,
"cds_start": null,
"cds_end": null,
"cds_length": 894,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000334557.10"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "ENST00000594922.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000594922.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "ENST00000596112.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000596112.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "ENST00000598667.1",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "ENST00000598667.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 18,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000943060.1",
"protein_id": "ENSP00000613119.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 633,
"cds_start": null,
"cds_end": null,
"cds_length": 1902,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943060.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000857074.1",
"protein_id": "ENSP00000527133.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 620,
"cds_start": null,
"cds_end": null,
"cds_length": 1863,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000857074.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000690137.1",
"protein_id": "ENSP00000509813.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 615,
"cds_start": null,
"cds_end": null,
"cds_length": 1848,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000690137.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000857075.1",
"protein_id": "ENSP00000527134.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 603,
"cds_start": null,
"cds_end": null,
"cds_length": 1812,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000857075.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000943061.1",
"protein_id": "ENSP00000613120.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 600,
"cds_start": null,
"cds_end": null,
"cds_length": 1803,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943061.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000691111.1",
"protein_id": "ENSP00000509552.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 599,
"cds_start": null,
"cds_end": null,
"cds_length": 1800,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000691111.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000687593.1",
"protein_id": "ENSP00000509270.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 594,
"cds_start": null,
"cds_end": null,
"cds_length": 1785,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000687593.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000370470.5",
"protein_id": "ENSP00000359501.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 590,
"cds_start": null,
"cds_end": null,
"cds_length": 1773,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000370470.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000690216.1",
"protein_id": "ENSP00000510631.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 587,
"cds_start": null,
"cds_end": null,
"cds_length": 1764,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000690216.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000686086.1",
"protein_id": "ENSP00000510759.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 570,
"cds_start": null,
"cds_end": null,
"cds_length": 1713,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000686086.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000691214.1",
"protein_id": "ENSP00000510362.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 569,
"cds_start": null,
"cds_end": null,
"cds_length": 1710,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000691214.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000495717.6",
"protein_id": "ENSP00000481474.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 561,
"cds_start": null,
"cds_end": null,
"cds_length": 1686,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000495717.6"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000685491.1",
"protein_id": "ENSP00000509963.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 559,
"cds_start": null,
"cds_end": null,
"cds_length": 1680,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000685491.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000943063.1",
"protein_id": "ENSP00000613122.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 549,
"cds_start": null,
"cds_end": null,
"cds_length": 1650,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943063.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000943064.1",
"protein_id": "ENSP00000613123.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 545,
"cds_start": null,
"cds_end": null,
"cds_length": 1638,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000943064.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000616382.5",
"protein_id": "ENSP00000481058.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": 536,
"cds_start": null,
"cds_end": null,
"cds_length": 1611,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000616382.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-488_-487insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000692108.1",
"protein_id": "ENSP00000508963.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 509,
"cds_start": null,
"cds_end": null,
"cds_length": 1530,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000692108.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-893_-892insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000689517.1",
"protein_id": "ENSP00000510686.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 460,
"cds_start": null,
"cds_end": null,
"cds_length": 1383,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000689517.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 13,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000693512.1",
"protein_id": "ENSP00000509589.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 398,
"cds_start": null,
"cds_end": null,
"cds_length": 1197,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000693512.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 7,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000857076.1",
"protein_id": "ENSP00000527135.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 188,
"cds_start": null,
"cds_end": null,
"cds_length": 567,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000857076.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "c.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000621447.1",
"protein_id": "ENSP00000484324.1",
"transcript_support_level": 3,
"aa_start": null,
"aa_end": null,
"aa_length": 31,
"cds_start": null,
"cds_end": null,
"cds_length": 96,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "protein_coding",
"feature": "ENST00000621447.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 16,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000475038.3",
"protein_id": "ENSP00000480450.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000475038.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-31_-30insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000492846.2",
"protein_id": null,
"transcript_support_level": 2,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000492846.2"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "ENST00000601841.1",
"protein_id": null,
"transcript_support_level": 6,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000601841.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 17,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000621987.5",
"protein_id": "ENSP00000477839.1",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000621987.5"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-31_-30insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000689570.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000689570.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-31_-30insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000691793.1",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "retained_intron",
"feature": "ENST00000691793.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000692091.1",
"protein_id": "ENSP00000509221.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000692091.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 15,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"hgvs_c": "n.-131_-130insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000693452.1",
"protein_id": "ENSP00000510026.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "nonsense_mediated_decay",
"feature": "ENST00000693452.1"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "NR_024499.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_024499.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "NR_024501.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_024501.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "NR_024502.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_024502.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"upstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 2,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "FMR1-AS1",
"gene_hgnc_id": 39081,
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null,
"transcript": "NR_024503.3",
"protein_id": null,
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "pseudogene",
"feature": "NR_024503.3"
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"downstream_gene_variant"
],
"exon_rank": null,
"exon_rank_end": null,
"exon_count": 1,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "ENSG00000274086",
"gene_hgnc_id": null,
"hgvs_c": "n.*101_*102insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null,
"transcript": "ENST00000613724.1",
"protein_id": null,
"transcript_support_level": 6,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": null,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": null,
"mane_select": null,
"mane_plus": null,
"biotype": "misc_RNA",
"feature": "ENST00000613724.1"
}
],
"gene_symbol": "FMR1",
"gene_hgnc_id": 3775,
"dbsnp": "rs193922936",
"frequency_reference_population": 0.0000852927,
"hom_count_reference_population": 1,
"allele_count_reference_population": 3,
"gnomad_exomes_af": null,
"gnomad_genomes_af": 0.0000852927,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": 3,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 0.618,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "NM_002024.6",
"gene_symbol": "FMR1",
"hgnc_id": 3775,
"effects": [
"5_prime_UTR_variant"
],
"inheritance_mode": "XL",
"hgvs_c": "c.-100_-99insCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG",
"hgvs_p": null
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000594922.5",
"gene_symbol": "FMR1-AS1",
"hgnc_id": 39081,
"effects": [
"upstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.-233_-232insCTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCGC",
"hgvs_p": null
},
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000613724.1",
"gene_symbol": "ENSG00000274086",
"hgnc_id": null,
"effects": [
"downstream_gene_variant"
],
"inheritance_mode": "",
"hgvs_c": "n.*101_*102insGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAG",
"hgvs_p": null
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}