← Back to variant description
GeneBe API Showcase
This page demonstrates how to use the GeneBe API to query variant information. The API provides programmatic access to genomic annotations and variant data.
API presented here should be used for checking single variants. If you want to check many variants at once, please use other API endpoints that you will find in the documentation.
Documentation & Advanced Usage
• Complete API documentation:docs.genebe.net/docs/api/overview/
• Interactive endpoint tester:api.genebe.net/cloud/gb-api-doc/swagger-ui/
• Python client for pandas:pypi.org/project/genebe/
• Java CLI for VCF files:github.com/pstawinski/genebe-cli
• All tools documented at:docs.genebe.net
API Request Examples for Variant: X-67546514-T-TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC (hg38)
Bash / cURL Example
bash
curl "https://api.genebe.net/cloud/api-public/v1/variant?chr=X&pos=67546514&ref=T&alt=TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC&genome=hg38&allGenes=true"
API Response
json
{
"variants": [
{
"chr": "X",
"pos": 67546514,
"ref": "T",
"alt": "TGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC",
"effect": "disruptive_inframe_insertion",
"transcript": "ENST00000374690.9",
"consequences": [
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "NM_000044.6",
"protein_id": "NP_000035.2",
"transcript_support_level": null,
"aa_start": 474,
"aa_end": null,
"aa_length": 920,
"cds_start": 1421,
"cds_end": null,
"cds_length": 2763,
"cdna_start": 2547,
"cdna_end": null,
"cdna_length": 10667,
"mane_select": "ENST00000374690.9",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": true,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 8,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "ENST00000374690.9",
"protein_id": "ENSP00000363822.3",
"transcript_support_level": 1,
"aa_start": 474,
"aa_end": null,
"aa_length": 920,
"cds_start": 1421,
"cds_end": null,
"cds_length": 2763,
"cdna_start": 2547,
"cdna_end": null,
"cdna_length": 10667,
"mane_select": "NM_000044.6",
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "ENST00000396044.8",
"protein_id": "ENSP00000379359.3",
"transcript_support_level": 1,
"aa_start": 474,
"aa_end": null,
"aa_length": 734,
"cds_start": 1421,
"cds_end": null,
"cds_length": 2205,
"cdna_start": 1424,
"cdna_end": null,
"cdna_length": 2427,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "ENST00000504326.5",
"protein_id": "ENSP00000421155.1",
"transcript_support_level": 1,
"aa_start": 474,
"aa_end": null,
"aa_length": 644,
"cds_start": 1421,
"cds_end": null,
"cds_length": 1935,
"cdna_start": 1748,
"cdna_end": null,
"cdna_length": 3615,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "n.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000396043.4",
"protein_id": "ENSP00000379358.4",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 4523,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "n.1718_1747dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000513847.5",
"protein_id": null,
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 2420,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 5,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "n.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000514029.5",
"protein_id": "ENSP00000425199.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3899,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "n.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000613054.2",
"protein_id": "ENSP00000479013.1",
"transcript_support_level": 1,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 3532,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "NM_001348063.1",
"protein_id": "NP_001334992.1",
"transcript_support_level": null,
"aa_start": 474,
"aa_end": null,
"aa_length": 648,
"cds_start": 1421,
"cds_end": null,
"cds_length": 1947,
"cdna_start": 1945,
"cdna_end": null,
"cdna_length": 2612,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 4,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "NM_001348061.1",
"protein_id": "NP_001334990.1",
"transcript_support_level": null,
"aa_start": 474,
"aa_end": null,
"aa_length": 644,
"cds_start": 1421,
"cds_end": null,
"cds_length": 1935,
"cdna_start": 1945,
"cdna_end": null,
"cdna_length": 3812,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": "E",
"aa_alt": "GGGGGGGGGGE",
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"disruptive_inframe_insertion"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 3,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup",
"transcript": "NM_001348064.1",
"protein_id": "NP_001334993.1",
"transcript_support_level": null,
"aa_start": 474,
"aa_end": null,
"aa_length": 572,
"cds_start": 1421,
"cds_end": null,
"cds_length": 1719,
"cdna_start": 1945,
"cdna_end": null,
"cdna_length": 3729,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": false,
"strand": true,
"consequences": [
"non_coding_transcript_exon_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "n.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "ENST00000612452.5",
"protein_id": "ENSP00000484033.2",
"transcript_support_level": 5,
"aa_start": null,
"aa_end": null,
"aa_length": null,
"cds_start": -4,
"cds_end": null,
"cds_length": null,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 7630,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
},
{
"aa_ref": null,
"aa_alt": null,
"canonical": false,
"protein_coding": true,
"strand": true,
"consequences": [
"5_prime_UTR_variant"
],
"exon_rank": 1,
"exon_rank_end": null,
"exon_count": 9,
"intron_rank": null,
"intron_rank_end": null,
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"hgvs_c": "c.-393_-364dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": null,
"transcript": "NM_001011645.3",
"protein_id": "NP_001011645.1",
"transcript_support_level": null,
"aa_start": null,
"aa_end": null,
"aa_length": 388,
"cds_start": -4,
"cds_end": null,
"cds_length": 1167,
"cdna_start": null,
"cdna_end": null,
"cdna_length": 10252,
"mane_select": null,
"mane_plus": null,
"biotype": null,
"feature": null
}
],
"gene_symbol": "AR",
"gene_hgnc_id": 644,
"dbsnp": "rs746853821",
"frequency_reference_population": 0.000060198898,
"hom_count_reference_population": 0,
"allele_count_reference_population": 5,
"gnomad_exomes_af": null,
"gnomad_genomes_af": 0.0000601989,
"gnomad_exomes_ac": null,
"gnomad_genomes_ac": 5,
"gnomad_exomes_homalt": null,
"gnomad_genomes_homalt": 0,
"gnomad_mito_homoplasmic": null,
"gnomad_mito_heteroplasmic": null,
"computational_score_selected": null,
"computational_prediction_selected": null,
"computational_source_selected": null,
"splice_score_selected": null,
"splice_prediction_selected": null,
"splice_source_selected": null,
"revel_score": null,
"revel_prediction": null,
"alphamissense_score": null,
"alphamissense_prediction": null,
"bayesdelnoaf_score": null,
"bayesdelnoaf_prediction": null,
"phylop100way_score": 1.295,
"phylop100way_prediction": "Benign",
"spliceai_max_score": null,
"spliceai_max_prediction": null,
"dbscsnv_ada_score": null,
"dbscsnv_ada_prediction": null,
"apogee2_score": null,
"apogee2_prediction": null,
"mitotip_score": null,
"mitotip_prediction": null,
"acmg_score": 0,
"acmg_classification": "Uncertain_significance",
"acmg_criteria": "",
"acmg_by_gene": [
{
"score": 0,
"benign_score": 0,
"pathogenic_score": 0,
"criteria": [],
"verdict": "Uncertain_significance",
"transcript": "ENST00000374690.9",
"gene_symbol": "AR",
"hgnc_id": 644,
"effects": [
"disruptive_inframe_insertion"
],
"inheritance_mode": "XL",
"hgvs_c": "c.1391_1420dupGCGGCGGCGGCGGCGGCGGCGGCGGCGGCG",
"hgvs_p": "p.Gly464_Gly473dup"
}
],
"clinvar_disease": "",
"clinvar_classification": "",
"clinvar_review_status": "",
"clinvar_submissions_summary": "",
"phenotype_combined": null,
"pathogenicity_classification_combined": null,
"custom_annotations": null
}
],
"message": null
}