ACVR1

activin A receptor type 1, the group of Type 1 receptor serine/threonine kinases

Basic information

Region (hg38): 2:157736250-157876330

Previous symbols: [ "ACVRLK2" ]

Links

ENSG00000115170 ∙ NCBI:90 ∙ OMIM:102576 ∙ HGNC:171 ∙ Uniprot:Q04771 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• fibrodysplasia ossificans progressiva (Strong), mode of inheritance: AD
• fibrodysplasia ossificans progressiva (Moderate), mode of inheritance: AD
• fibrodysplasia ossificans progressiva (Supportive), mode of inheritance: AD
• fibrodysplasia ossificans progressiva (Strong), mode of inheritance: AD
• fibrodysplasia ossificans progressiva (Definitive), mode of inheritance: AD
• congenital heart disease (Limited), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Fibrodysplasia ossificans progressiva	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Musculoskeletal	8758048; 17077940; 16642017; 17351709; 18830232; 19330033; 24259422

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ACVR1 gene.

• not provided (191 variants)
• Progressive myositis ossificans (56 variants)
• Inborn genetic diseases (17 variants)
• not specified (4 variants)
• Brainstem glioma (3 variants)
• Diffuse intrinsic pontine glioma (1 variants)
• Gastric adenocarcinoma (1 variants)
• Epicanthus (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ACVR1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	44	10	56
missense	2	2	68	9	2	83
nonsense			4			4
start loss			1			1
frameshift			2			2
inframe indel			1			1
splice donor/acceptor (+/-2bp)			2			2
splice region			2	7	2	11
non coding			15	22	30	67
Total	2	2	95	75	42

Variants in ACVR1

This is a list of pathogenic ClinVar variants found in the ACVR1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-157736494-CA-C		Progressive myositis ossificans	Uncertain significance (Jun 14, 2016)
2-157736740-T-A		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157736769-T-C		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157736779-T-C		Progressive myositis ossificans	Uncertain significance (Jan 13, 2018)
2-157736780-A-C		Progressive myositis ossificans	Uncertain significance (Jan 13, 2018)
2-157736820-T-C		Progressive myositis ossificans	Uncertain significance (Jan 13, 2018)
2-157736845-A-G		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157737031-C-T		Progressive myositis ossificans	Uncertain significance (Jan 13, 2018)
2-157737110-C-T		Progressive myositis ossificans	Uncertain significance (Jan 12, 2018)
2-157737173-C-T		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157737217-T-G		Progressive myositis ossificans	Uncertain significance (Jan 12, 2018)
2-157737281-G-C		Progressive myositis ossificans	Uncertain significance (Jan 13, 2018)
2-157737321-T-G		Progressive myositis ossificans	Uncertain significance (Jan 13, 2018)
2-157737326-TGCCCAGTTCACAGTCATCGAGCGAGGTTAGGGTGGTTTTGATGTCTCCCCAACACATGGCTGGGTACGACGTCTGCCTTGTCAAAGCAGCCATTTGGGGAGGGAGACAGATGGATTCCATTCTGACAACCAGTCAGGCCAGCATTAGGTCCCAGCTGGACAATGACAACAACGTCAAATCTTCCTTCTTGACACTATGAAAATGTCAACAGTCAGTTTTCAATTTGTCGAGGGAATTATCAATTTTGGTCAAAGTCTTTTTGATACGCAGTGCTGTGAGTCTTGCGGATG-T			Uncertain significance (Nov 01, 2022)
2-157737348-C-T		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157737349-G-A		Progressive myositis ossificans	Uncertain significance (Jan 12, 2018)
2-157737379-C-T		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157737393-C-T		Progressive myositis ossificans	Benign (Dec 05, 2021)
2-157737394-G-A		Progressive myositis ossificans	Uncertain significance (Jan 12, 2018)
2-157737484-G-A		Progressive myositis ossificans	Benign (Jan 13, 2018)
2-157737486-C-A		Progressive myositis ossificans	Benign (Dec 05, 2021)
2-157737539-C-CA			Uncertain significance (Oct 23, 2020)
2-157737548-A-G		Progressive myositis ossificans	Benign (Jan 29, 2024)
2-157737552-G-A			Likely benign (Aug 18, 2023)
2-157737555-G-A		Progressive myositis ossificans	Benign (Jan 19, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ACVR1	protein_coding	protein_coding	ENST00000263640	9	139417

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.325	0.675	125727	0	18	125745	0.0000716

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.34	176	288	0.612	0.0000162	3350
Missense in Polyphen		62	150.78	0.41119		1758
Synonymous	0.364	103	108	0.955	0.00000658	966
Loss of Function	3.64	6	26.1	0.230	0.00000142	288

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000904	0.0000904
Ashkenazi Jewish	0.000199	0.000198
East Asian	0.0000545	0.0000544
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.0000793	0.0000791
Middle Eastern	0.0000545	0.0000544
South Asian	0.0000980	0.0000980
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for activin. May be involved for left-right pattern formation during embryogenesis (By similarity). {ECO:0000250}.
• Pathway: TGF-beta signaling pathway - Homo sapiens (human);Signaling pathways regulating pluripotency of stem cells - Homo sapiens (human);Fluid shear stress and atherosclerosis - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);TGF-Core;Mesodermal Commitment Pathway;ESC Pluripotency Pathways;TGF-beta super family signaling pathway canonical;IL-7 signaling;JAK STAT pathway and regulation;EPO signaling;BMP2 signaling TGF-beta MV;VEGF;ALK1 signaling events;ALK2 signaling events (Consensus)

Recessive Scores

• pRec: 0.384

Intolerance Scores

• loftool: 0.138
• rvis_EVS: -0.51
• rvis_percentile_EVS: 21.41

Haploinsufficiency Scores

• pHI: 0.995
• hipred: Y
• hipred_score: 0.825
• ghis: 0.618

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.998

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Acvr1
• Phenotype: cellular phenotype; homeostasis/metabolism phenotype; craniofacial phenotype; muscle phenotype; growth/size/body region phenotype; embryo phenotype; skeleton phenotype; immune system phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); hearing/vestibular/ear phenotype; limbs/digits/tail phenotype; digestive/alimentary phenotype; neoplasm; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan)

Gene ontology

• Biological process: G1/S transition of mitotic cell cycle;branching involved in blood vessel morphogenesis;in utero embryonic development;gastrulation with mouth forming second;mesoderm formation;neural crest cell migration;acute inflammatory response;embryonic heart tube morphogenesis;outflow tract septum morphogenesis;atrioventricular valve morphogenesis;mitral valve morphogenesis;endocardial cushion morphogenesis;endocardial cushion fusion;atrial septum primum morphogenesis;protein phosphorylation;transforming growth factor beta receptor signaling pathway;germ cell development;determination of left/right symmetry;pattern specification process;heart development;negative regulation of signal transduction;positive regulation of pathway-restricted SMAD protein phosphorylation;peptidyl-threonine phosphorylation;regulation of ossification;positive regulation of cell migration;positive regulation of bone mineralization;BMP signaling pathway;activin receptor signaling pathway;negative regulation of activin receptor signaling pathway;positive regulation of osteoblast differentiation;positive regulation of transcription, DNA-templated;positive regulation of transcription by RNA polymerase II;smooth muscle cell differentiation;pharyngeal system development;pathway-restricted SMAD protein phosphorylation;ventricular septum morphogenesis;cardiac muscle cell fate commitment;BMP signaling pathway involved in heart development;endocardial cushion cell fate commitment;cellular response to BMP stimulus;positive regulation of epithelial to mesenchymal transition involved in endocardial cushion formation;positive regulation of determination of dorsal identity;negative regulation of extrinsic apoptotic signaling pathway
• Cellular component: integral component of plasma membrane;receptor complex;apical part of cell;activin receptor complex
• Molecular function: protein kinase activity;protein serine/threonine kinase activity;transmembrane receptor protein serine/threonine kinase activity;transforming growth factor beta-activated receptor activity;transforming growth factor beta receptor activity, type I;protein binding;ATP binding;activin receptor activity, type I;peptide hormone binding;growth factor binding;protein homodimerization activity;SMAD binding;metal ion binding;activin binding;transforming growth factor beta binding;BMP receptor activity