ACVR1B
activin A receptor type 1B, the group of Type 1 receptor serine/threonine kinases
Basic information
Region (hg38): 12:51951699-51997078
Previous symbols: [ "ACVRLK4" ]
Links
Phenotypes
GenCC
Source:
- malignant pancreatic neoplasm (No Known Disease Relationship), mode of inheritance: Unknown
ClinVar
This is a list of variants' phenotypes submitted to
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the ACVR1B gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 1 | |||||
| missense | 13 | 13 | ||||
| nonsense | 0 | |||||
| start loss | 0 | |||||
| frameshift | 0 | |||||
| inframe indel | 0 | |||||
| splice donor/acceptor (+/-2bp) | 0 | |||||
| splice region | 0 | |||||
| non coding | 3 | |||||
| Total | 0 | 0 | 15 | 0 | 2 |
Variants in ACVR1B
This is a list of pathogenic ClinVar variants found in the ACVR1B region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 12-51951754-C-T | not specified | Uncertain significance (Dec 15, 2022) | ||
| 12-51951778-C-A | not specified | Uncertain significance (Dec 12, 2023) | ||
| 12-51951789-C-T | not specified | Uncertain significance (Sep 21, 2023) | ||
| 12-51951807-G-A | not specified | Uncertain significance (Mar 11, 2024) | ||
| 12-51954475-A-G | Benign (Oct 16, 2019) | |||
| 12-51975276-G-A | not specified | Uncertain significance (Jun 10, 2024) | ||
| 12-51975486-G-A | not specified | Uncertain significance (Dec 05, 2022) | ||
| 12-51976416-A-C | not specified | Uncertain significance (Aug 14, 2023) | ||
| 12-51976528-C-T | not specified | Uncertain significance (Mar 18, 2024) | ||
| 12-51976558-C-T | not specified | Uncertain significance (Apr 15, 2024) | ||
| 12-51982700-C-T | not specified | Uncertain significance (Mar 21, 2023) | ||
| 12-51982736-G-T | not specified | Uncertain significance (Apr 08, 2024) | ||
| 12-51982794-T-G | not specified | Uncertain significance (Sep 26, 2023) | ||
| 12-51984004-G-C | not specified | Uncertain significance (Nov 13, 2023) | ||
| 12-51984099-G-A | Transposition of the great arteries, dextro-looped | Pathogenic (May 19, 2014) | ||
| 12-51984124-A-G | not specified | Uncertain significance (May 31, 2023) | ||
| 12-51986825-G-A | not specified | Uncertain significance (Nov 03, 2022) | ||
| 12-51986839-TGATGA-T | Carcinoma of pancreas | Pathogenic (Mar 13, 2001) | ||
| 12-51986922-C-A | not specified | Uncertain significance (Dec 03, 2021) | ||
| 12-51986924-C-G | not specified | Uncertain significance (Jan 26, 2022) | ||
| 12-51991356-TGGCTATGAAAAAAAATGTTCCTGGCTACTCTTTTGTATTTCTTTTTGTTTAGTTGTTTTGTTTGAGACAGAGTCTTGCACTCTTGTCCAGGCTGGAGTGCAGTGGCATGATCTCTGCTCACTGCAACCTCTGCCTCCAGGGTTCAAGCTATTCTCCTGCCTCAGCCTCCCTAGTAGCTGGGACTACAGGTGTTTGCCACCATGCCTGGTTAATTTTTGTATTTTTAGTAGAGATGGGGTTTTACCGTGTTGGCGGGGCTGGTTTCAAACTACTGATCTCAGGTGATCCGCTTGCCTTGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCATGCCCGGCCCCTTTTGTGTATTTCTTGTTCCATACTTAGAATTAACTAACTTTCTAAGGAACCTTAGGGGGTAGTGGTATTTACAGAGCACAGTGTAGGTTTTGTCACCGGCTTCTGAGTAATCTTTTCCTGCTGTTGATAACTCAGGTAGATACTTTCTTTTCTCCCAGGAGTCCATGAAGAATATCAGCTGCCATATTACGACTTAGTGCCCTCTGACCCTTCCATTGAGGAAATGCGAAAGGTTGTATGTGATCAGAAGCTGCGTCCCAACATCCCCAACTGGTGGCAGAGTTATGAGGTAAGAAGCTGGCCTCCTGC-T | Carcinoma of pancreas | Pathogenic (Mar 13, 2001) | ||
| 12-51991965-A-G | not specified | Uncertain significance (Jan 26, 2022) | ||
| 12-51991965-A-T | not specified | Uncertain significance (May 23, 2023) | ||
| 12-51994074-C-T | Benign (May 24, 2018) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| ACVR1B | protein_coding | protein_coding | ENST00000541224 | 10 | 45412 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 1.00 | 0.000314 | 125745 | 0 | 2 | 125747 | 0.00000795 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 3.37 | 148 | 317 | 0.467 | 0.0000189 | 3540 |
| Missense in Polyphen | 58 | 168.75 | 0.34371 | 1743 | ||
| Synonymous | 0.554 | 113 | 121 | 0.936 | 0.00000713 | 1084 |
| Loss of Function | 4.69 | 1 | 27.5 | 0.0363 | 0.00000164 | 300 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.0000289 | 0.0000289 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.00000879 | 0.00000879 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.00 | 0.00 |
| Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Transmembrane serine/threonine kinase activin type-1 receptor forming an activin receptor complex with activin receptor type-2 (ACVR2A or ACVR2B). Transduces the activin signal from the cell surface to the cytoplasm and is thus regulating a many physiological and pathological processes including neuronal differentiation and neuronal survival, hair follicle development and cycling, FSH production by the pituitary gland, wound healing, extracellular matrix production, immunosuppression and carcinogenesis. Activin is also thought to have a paracrine or autocrine role in follicular development in the ovary. Within the receptor complex, type-2 receptors (ACVR2A and/or ACVR2B) act as a primary activin receptors whereas the type-1 receptors like ACVR1B act as downstream transducers of activin signals. Activin binds to type-2 receptor at the plasma membrane and activates its serine- threonine kinase. The activated receptor type-2 then phosphorylates and activates the type-1 receptor such as ACVR1B. Once activated, the type-1 receptor binds and phosphorylates the SMAD proteins SMAD2 and SMAD3, on serine residues of the C- terminal tail. Soon after their association with the activin receptor and subsequent phosphorylation, SMAD2 and SMAD3 are released into the cytoplasm where they interact with the common partner SMAD4. This SMAD complex translocates into the nucleus where it mediates activin-induced transcription. Inhibitory SMAD7, which is recruited to ACVR1B through FKBP1A, can prevent the association of SMAD2 and SMAD3 with the activin receptor complex, thereby blocking the activin signal. Activin signal transduction is also antagonized by the binding to the receptor of inhibin-B via the IGSF1 inhibin coreceptor. ACVR1B also phosphorylates TDP2. {ECO:0000269|PubMed:12364468, ECO:0000269|PubMed:12639945, ECO:0000269|PubMed:18039968, ECO:0000269|PubMed:20226172, ECO:0000269|PubMed:8196624, ECO:0000269|PubMed:9032295, ECO:0000269|PubMed:9892009}.;
- Disease
- DISEASE: Note=ACVRIB is abundantly expressed in systemic sclerosis patient fibroblasts and production of collagen is also induced by activin-A/INHBA. This suggests that the activin/ACRV1B signaling mechanism is involved in systemic sclerosis. {ECO:0000269|PubMed:21377836}.;
- Pathway
- TGF-beta signaling pathway - Homo sapiens (human);Signaling pathways regulating pluripotency of stem cells - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);TGF-Core;miR-targeted genes in muscle cell - TarBase;Hematopoietic Stem Cell Differentiation;Developmental Biology;Regulation of signaling by NODAL;Signal Transduction;Signaling by Activin;TGF-beta super family signaling pathway canonical;Signaling by NODAL;IL-7 signaling;JAK STAT pathway and regulation;EPO signaling;BMP2 signaling TGF-beta MV;VEGF;Signaling by TGF-beta family members
(Consensus)
Recessive Scores
- pRec
- 0.297
Intolerance Scores
- loftool
- 0.0435
- rvis_EVS
- -0.41
- rvis_percentile_EVS
- 26.23
Haploinsufficiency Scores
- pHI
- 0.885
- hipred
- Y
- hipred_score
- 0.825
- ghis
- 0.619
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.997
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Acvr1b
- Phenotype
- mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; reproductive system phenotype; embryo phenotype; respiratory system phenotype; skeleton phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); craniofacial phenotype; growth/size/body region phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype; cellular phenotype;
Zebrafish Information Network
- Gene name
- acvr1ba
- Affected structure
- fin regeneration
- Phenotype tag
- abnormal
- Phenotype quality
- disrupted
Gene ontology
- Biological process
- G1/S transition of mitotic cell cycle;in utero embryonic development;hair follicle development;regulation of transcription, DNA-templated;protein phosphorylation;signal transduction;transmembrane receptor protein serine/threonine kinase signaling pathway;transforming growth factor beta receptor signaling pathway;pattern specification process;central nervous system development;negative regulation of gene expression;positive regulation of pathway-restricted SMAD protein phosphorylation;peptidyl-threonine phosphorylation;negative regulation of cell growth;activin receptor signaling pathway;positive regulation of activin receptor signaling pathway;nodal signaling pathway;positive regulation of erythrocyte differentiation;positive regulation of transcription by RNA polymerase II;development of primary female sexual characteristics;protein autophosphorylation;extrinsic apoptotic signaling pathway;positive regulation of trophoblast cell migration
- Cellular component
- cytosol;plasma membrane;integral component of plasma membrane;cell surface;receptor complex;activin receptor complex
- Molecular function
- protein serine/threonine kinase activity;transmembrane receptor protein serine/threonine kinase activity;transforming growth factor beta-activated receptor activity;transforming growth factor beta receptor activity, type I;protein binding;ATP binding;activin receptor activity, type I;activin-activated receptor activity;growth factor binding;ubiquitin protein ligase binding;inhibin binding;SMAD binding;metal ion binding;activin binding