AR
androgen receptor, the group of Nuclear receptor subfamily 3 group C
Basic information
Region (hg38): X:67544021-67730619
Previous symbols: [ "DHTR", "SBMA" ]
Links
Phenotypes
GenCC
Source:
- partial androgen insensitivity syndrome (Strong), mode of inheritance: XL
- androgen insensitivity syndrome (Definitive), mode of inheritance: XL
- Kennedy disease (Strong), mode of inheritance: XL
- androgen insensitivity syndrome (Strong), mode of inheritance: XL
- Kennedy disease (Supportive), mode of inheritance: XL
- partial androgen insensitivity syndrome (Supportive), mode of inheritance: XL
- complete androgen insensitivity syndrome (Supportive), mode of inheritance: XL
- Kennedy disease (Definitive), mode of inheritance: XL
- androgen insensitivity syndrome (Definitive), mode of inheritance: XL
- androgen insensitivity syndrome (Strong), mode of inheritance: XL
- Kennedy disease (Strong), mode of inheritance: XL
- Kennedy disease (Definitive), mode of inheritance: XL
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Androgen insensitivity; Androgen insensitivity, partial | XL | Endocrine; Oncologic; Genitourinary | Treatment with testosterone, starting at an early age may enable fertility; Surveillance for breast cancer may be beneficial | Endocrine; Genitourinary; Neurologic; Oncologic | 17564966; 21057504; 20929961; 22499348 |
ClinVar
This is a list of variants' phenotypes submitted to
- Androgen resistance syndrome;Kennedy disease (58 variants)
- not provided (51 variants)
- Androgen resistance syndrome (38 variants)
- Kennedy disease;Androgen resistance syndrome (34 variants)
- Partial androgen insensitivity syndrome (5 variants)
- Malignant tumor of prostate (4 variants)
- AR-related disorder (3 variants)
- Male infertility (3 variants)
- See cases (2 variants)
- Partial androgen insensitivity syndrome;Malignant tumor of prostate;Hypospadias 1, X-linked;Kennedy disease;Androgen resistance syndrome (1 variants)
- Hypospadias 1, X-linked (1 variants)
- Pure gonadal dysgenesis 46,XY (1 variants)
- Aplasia of the uterus;Female external genitalia in individual with 46,XY karyotype;Absent pubic hair;Absent axillary hair (1 variants)
- Non-obstructive azoospermia (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the AR gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 188 | 42 | 231 | |||
| missense | 40 | 67 | 98 | 15 | 19 | 239 |
| nonsense | 54 | 55 | ||||
| start loss | 1 | |||||
| frameshift | 39 | 46 | ||||
| inframe indel | 33 | 22 | 64 | |||
| splice donor/acceptor (+/-2bp) | 9 | |||||
| splice region | 1 | 1 | 5 | 12 | 2 | 21 |
| non coding | 47 | 24 | 76 | |||
| Total | 142 | 80 | 109 | 283 | 107 |
Highest pathogenic variant AF is 0.0000982
Variants in AR
This is a list of pathogenic ClinVar variants found in the AR region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| X-67544234-C-A | Likely benign (Jan 01, 2023) | |||
| X-67544600-C-T | AR-related disorder | Likely pathogenic (Jul 18, 2024) | ||
| X-67544604-C-A | AR-related disorder | Likely benign (Jun 21, 2019) | ||
| X-67545147-A-T | Kennedy disease;Androgen resistance syndrome | Pathogenic (Jul 14, 2023) | ||
| X-67545149-G-A | Androgen resistance syndrome | Pathogenic (Jul 04, 2024) | ||
| X-67545150-G-A | Partial androgen insensitivity syndrome | Pathogenic (Sep 15, 1996) | ||
| X-67545151-A-G | Androgen resistance syndrome;Kennedy disease | Uncertain significance (Dec 08, 2019) | ||
| X-67545153-G-A | Androgen resistance syndrome;Kennedy disease • Androgen resistance syndrome;Partial androgen insensitivity syndrome;Malignant tumor of prostate;Hypospadias 1, X-linked;Kennedy disease • Ovarian cancer | Conflicting classifications of pathogenicity (Feb 09, 2022) | ||
| X-67545163-G-GGCTGGGAAGGGTCTACCCTCGGCCGCCGTCCAAGACCTACCGAGGAGCTTTCCAGAATCTGTTCCAGAGCGTGCGCGAAGTGATCCAGAACCCGGGCCCCAGGCACCCAGAGGCCGCGA | Pathogenic (Jan 16, 2018) | |||
| X-67545178-AC-A | Androgen resistance syndrome | Likely pathogenic (-) | ||
| X-67545185-G-A | Androgen resistance syndrome;Kennedy disease | Benign (Jan 04, 2024) | ||
| X-67545191-G-A | Androgen resistance syndrome;Kennedy disease | Benign (Jan 31, 2024) | ||
| X-67545191-G-T | Androgen resistance syndrome;Kennedy disease | Likely benign (Dec 21, 2023) | ||
| X-67545197-G-T | Androgen resistance syndrome;Kennedy disease | Likely benign (Nov 25, 2023) | ||
| X-67545197-G-GA | Androgen resistance syndrome;Kennedy disease | Pathogenic (Aug 17, 2020) | ||
| X-67545214-TC-T | Pathogenic (Jun 05, 2023) | |||
| X-67545233-C-T | Androgen resistance syndrome;Kennedy disease | Likely benign (Jan 17, 2023) | ||
| X-67545234-G-A | not specified | Uncertain significance (Jul 15, 2024) | ||
| X-67545247-T-A | Inborn genetic diseases | Uncertain significance (Sep 15, 2021) | ||
| X-67545265-G-A | Androgen resistance syndrome;Kennedy disease | Likely benign (Jan 04, 2024) | ||
| X-67545273-G-C | Inborn genetic diseases | Uncertain significance (May 23, 2023) | ||
| X-67545280-C-G | Kennedy disease;Androgen resistance syndrome | Likely benign (Jan 31, 2024) | ||
| X-67545296-C-T | Androgen resistance syndrome;Kennedy disease | Likely benign (Oct 18, 2023) | ||
| X-67545306-TTGC-T | Androgen resistance syndrome;Kennedy disease • AR-related disorder | Likely benign (Jan 15, 2024) | ||
| X-67545306-T-TTGC | Androgen resistance syndrome;Kennedy disease • Malignant tumor of prostate • Inborn genetic diseases | Conflicting classifications of pathogenicity (Jan 11, 2024) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| AR | protein_coding | protein_coding | ENST00000374690 | 8 | 185997 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.988 | 0.0116 | 125666 | 17 | 2 | 125685 | 0.0000756 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 1.23 | 286 | 351 | 0.816 | 0.0000250 | 5916 |
| Missense in Polyphen | 84 | 162.37 | 0.51735 | 2689 | ||
| Synonymous | -0.838 | 159 | 146 | 1.09 | 0.0000106 | 1867 |
| Loss of Function | 4.25 | 3 | 26.7 | 0.113 | 0.00000190 | 426 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.000870 | 0.000504 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.000602 | 0.000163 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.000109 | 0.0000440 |
| Middle Eastern | 0.000602 | 0.000163 |
| South Asian | 0.000230 | 0.0000653 |
| Other | 0.00155 | 0.000326 |
dbNSFP
Source:
- Function
- FUNCTION: Steroid hormone receptors are ligand-activated transcription factors that regulate eukaryotic gene expression and affect cellular proliferation and differentiation in target tissues. Transcription factor activity is modulated by bound coactivator and corepressor proteins like ZBTB7A that recruits NCOR1 and NCOR2 to the androgen response elements/ARE on target genes, negatively regulating androgen receptor signaling and androgen-induced cell proliferation (PubMed:20812024). Transcription activation is also down-regulated by NR0B2. Activated, but not phosphorylated, by HIPK3 and ZIPK/DAPK3. {ECO:0000269|PubMed:14664718, ECO:0000269|PubMed:15563469, ECO:0000269|PubMed:17591767, ECO:0000269|PubMed:17911242, ECO:0000269|PubMed:18084323, ECO:0000269|PubMed:19345326, ECO:0000269|PubMed:20812024, ECO:0000269|PubMed:20980437, ECO:0000269|PubMed:25091737}.;
- Disease
- DISEASE: Androgen insensitivity syndrome (AIS) [MIM:300068]: An X- linked recessive form of pseudohermaphroditism due end-organ resistance to androgen. Affected males have female external genitalia, female breast development, blind vagina, absent uterus and female adnexa, and abdominal or inguinal testes, despite a normal 46,XY karyotype. {ECO:0000269|PubMed:10022458, ECO:0000269|PubMed:10221692, ECO:0000269|PubMed:10221770, ECO:0000269|PubMed:10404311, ECO:0000269|PubMed:10458483, ECO:0000269|PubMed:10571951, ECO:0000269|PubMed:10590024, ECO:0000269|PubMed:10690872, ECO:0000269|PubMed:11587068, ECO:0000269|PubMed:11744994, ECO:0000269|PubMed:1307250, ECO:0000269|PubMed:1316540, ECO:0000269|PubMed:1426313, ECO:0000269|PubMed:1430233, ECO:0000269|PubMed:1464650, ECO:0000269|PubMed:14756668, ECO:0000269|PubMed:1480178, ECO:0000269|PubMed:1487249, ECO:0000269|PubMed:1569163, ECO:0000269|PubMed:1609793, ECO:0000269|PubMed:16129672, ECO:0000269|PubMed:16595706, ECO:0000269|PubMed:1775137, ECO:0000269|PubMed:1999491, ECO:0000269|PubMed:2082179, ECO:0000269|PubMed:2594783, ECO:0000269|PubMed:7537149, ECO:0000269|PubMed:7581399, ECO:0000269|PubMed:7633398, ECO:0000269|PubMed:7641413, ECO:0000269|PubMed:7671849, ECO:0000269|PubMed:7929841, ECO:0000269|PubMed:7962294, ECO:0000269|PubMed:7970939, ECO:0000269|PubMed:7981687, ECO:0000269|PubMed:7981689, ECO:0000269|PubMed:7993455, ECO:0000269|PubMed:8040309, ECO:0000269|PubMed:8096390, ECO:0000269|PubMed:8103398, ECO:0000269|PubMed:8162033, ECO:0000269|PubMed:8224266, ECO:0000269|PubMed:8281140, ECO:0000269|PubMed:8325950, ECO:0000269|PubMed:8339746, ECO:0000269|PubMed:8413310, ECO:0000269|PubMed:8446106, ECO:0000269|PubMed:8626869, ECO:0000269|PubMed:8647313, ECO:0000269|PubMed:8683794, ECO:0000269|PubMed:8723113, ECO:0000269|PubMed:8768864, ECO:0000269|PubMed:8809734, ECO:0000269|PubMed:8830623, ECO:0000269|PubMed:8918984, ECO:0000269|PubMed:8990010, ECO:0000269|PubMed:9001799, ECO:0000269|PubMed:9007482, ECO:0000269|PubMed:9039340, ECO:0000269|PubMed:9106550, ECO:0000269|PubMed:9160185, ECO:0000269|PubMed:9252933, ECO:0000269|PubMed:9255042, ECO:0000269|PubMed:9302173, ECO:0000269|PubMed:9328206, ECO:0000269|PubMed:9544375, ECO:0000269|PubMed:9554754, ECO:0000269|PubMed:9610419, ECO:0000269|PubMed:9627582, ECO:0000269|PubMed:9698822, ECO:0000269|PubMed:9851768, ECO:0000269|PubMed:9856504, ECO:0000269|Ref.113, ECO:0000269|Ref.179}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Spinal and bulbar muscular atrophy X-linked 1 (SMAX1) [MIM:313200]: An X-linked recessive form of spinal muscular atrophy. Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX1 occurs only in men. Age at onset is usually in the third to fifth decade of life, but earlier involvement has been reported. It is characterized by slowly progressive limb and bulbar muscle weakness with fasciculations, muscle atrophy, and gynecomastia. The disorder is clinically similar to classic forms of autosomal spinal muscular atrophy. {ECO:0000269|PubMed:15851746}. Note=The disease is caused by mutations affecting the gene represented in this entry. Caused by trinucleotide CAG repeat expansion. In SMAX1 patients the number of Gln ranges from 38 to 62. Longer expansions result in earlier onset and more severe clinical manifestations of the disease.; DISEASE: Note=Defects in AR may play a role in metastatic prostate cancer. The mutated receptor stimulates prostate growth and metastases development despite of androgen ablation. This treatment can reduce primary and metastatic lesions probably by inducing apoptosis of tumor cells when they express the wild-type receptor. {ECO:0000269|PubMed:10363963, ECO:0000269|PubMed:10569618, ECO:0000269|PubMed:1562539, ECO:0000269|PubMed:16129672, ECO:0000269|PubMed:17311914, ECO:0000269|PubMed:2260966, ECO:0000269|PubMed:25091737, ECO:0000269|PubMed:8187068, ECO:0000269|PubMed:8274409, ECO:0000269|PubMed:8827083}.; DISEASE: Androgen insensitivity, partial (PAIS) [MIM:312300]: A disorder that is characterized by hypospadias, hypogonadism, gynecomastia, genital ambiguity, normal XY karyotype, and a pedigree pattern consistent with X-linked recessive inheritance. Some patients present azoospermia or severe oligospermia without other clinical manifestations. {ECO:0000269|PubMed:10022458, ECO:0000269|PubMed:10221692, ECO:0000269|PubMed:10470409, ECO:0000269|PubMed:10502786, ECO:0000269|PubMed:10543676, ECO:0000269|PubMed:11587068, ECO:0000269|PubMed:1303262, ECO:0000269|PubMed:1307250, ECO:0000269|PubMed:1316540, ECO:0000269|PubMed:1424203, ECO:0000269|PubMed:1430233, ECO:0000269|PubMed:14756668, ECO:0000269|PubMed:2010552, ECO:0000269|PubMed:7581399, ECO:0000269|PubMed:7649358, ECO:0000269|PubMed:7671849, ECO:0000269|PubMed:7909256, ECO:0000269|PubMed:7910529, ECO:0000269|PubMed:7929841, ECO:0000269|PubMed:7970939, ECO:0000269|PubMed:7981687, ECO:0000269|PubMed:8033918, ECO:0000269|PubMed:8097257, ECO:0000269|PubMed:8126121, ECO:0000269|PubMed:8205256, ECO:0000269|PubMed:8281139, ECO:0000269|PubMed:8325932, ECO:0000269|PubMed:8325950, ECO:0000269|PubMed:8446106, ECO:0000269|PubMed:8550758, ECO:0000269|PubMed:8809734, ECO:0000269|PubMed:8823308, ECO:0000269|PubMed:8824883, ECO:0000269|PubMed:9039340, ECO:0000269|PubMed:9196614, ECO:0000269|PubMed:9302173, ECO:0000269|PubMed:9329414, ECO:0000269|PubMed:9543136, ECO:0000269|PubMed:9607727, ECO:0000269|PubMed:9768671, ECO:0000269|PubMed:9856504, ECO:0000269|Ref.121}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- Oocyte meiosis - Homo sapiens (human);Prostate cancer - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);NHR;Androgen receptor signaling pathway;Nuclear Receptors;Androgen Receptor Network in Prostate Cancer;miRNA regulation of prostate cancer signaling pathways;Sudden Infant Death Syndrome (SIDS) Susceptibility Pathways;RUNX2 regulates osteoblast differentiation;RUNX2 regulates bone development;Transcriptional regulation by RUNX2;Signal Transduction;Gene expression (Transcription);Generic Transcription Pathway;Alpha6Beta4Integrin;HSP90 chaperone cycle for steroid hormone receptors (SHR);Cellular responses to stress;Post-translational protein modification;Metabolism of proteins;Nuclear Receptor transcription pathway;RNA Polymerase II Transcription;AndrogenReceptor;Activated PKN1 stimulates transcription of AR (androgen receptor) regulated genes KLK2 and KLK3;RHO GTPases activate PKNs;Cellular responses to external stimuli;RHO GTPase Effectors;Signaling by Rho GTPases;TGF_beta_Receptor;Ub-specific processing proteases;Coregulation of Androgen receptor activity;FOXA1 transcription factor network;Deubiquitination;IL6;Regulation of nuclear beta catenin signaling and target gene transcription;Notch-mediated HES/HEY network;Regulation of Androgen receptor activity;Nongenotropic Androgen signaling;Regulation of nuclear SMAD2/3 signaling
(Consensus)
Recessive Scores
- pRec
- 0.975
Intolerance Scores
- loftool
- 0.0125
- rvis_EVS
- -0.62
- rvis_percentile_EVS
- 17.31
Haploinsufficiency Scores
- pHI
- 0.988
- hipred
- Y
- hipred_score
- 0.712
- ghis
- 0.507
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 1.00
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Ar
- Phenotype
- immune system phenotype; skeleton phenotype; renal/urinary system phenotype; limbs/digits/tail phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); digestive/alimentary phenotype; reproductive system phenotype; normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; neoplasm; pigmentation phenotype; embryo phenotype; liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); cellular phenotype; homeostasis/metabolism phenotype; muscle phenotype; craniofacial phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; endocrine/exocrine gland phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan);
Zebrafish Information Network
- Gene name
- ar
- Affected structure
- testis
- Phenotype tag
- abnormal
- Phenotype quality
- lacks all parts of type
Gene ontology
- Biological process
- negative regulation of transcription by RNA polymerase II;in utero embryonic development;regulation of systemic arterial blood pressure;epithelial cell morphogenesis;transcription, DNA-templated;transcription initiation from RNA polymerase II promoter;signal transduction;cell-cell signaling;spermatogenesis;single fertilization;sex differentiation;cell population proliferation;positive regulation of cell population proliferation;negative regulation of cell population proliferation;positive regulation of gene expression;protein deubiquitination;male somatic sex determination;androgen receptor signaling pathway;intracellular receptor signaling pathway;prostate gland development;positive regulation of intracellular estrogen receptor signaling pathway;Leydig cell differentiation;multicellular organism growth;positive regulation of phosphorylation;positive regulation of MAPK cascade;positive regulation of insulin-like growth factor receptor signaling pathway;positive regulation of cell differentiation;negative regulation of integrin biosynthetic process;positive regulation of integrin biosynthetic process;positive regulation of transcription, DNA-templated;positive regulation of transcription by RNA polymerase II;positive regulation of transcription by RNA polymerase III;regulation of developmental growth;animal organ formation;male genitalia morphogenesis;negative regulation of epithelial cell proliferation;regulation of catalytic activity;positive regulation of NF-kappaB transcription factor activity;protein complex oligomerization;activation of prostate induction by androgen receptor signaling pathway;morphogenesis of an epithelial fold;lateral sprouting involved in mammary gland duct morphogenesis;prostate gland growth;prostate gland epithelium morphogenesis;epithelial cell differentiation involved in prostate gland development;tertiary branching involved in mammary gland duct morphogenesis;mammary gland alveolus development;positive regulation of epithelial cell proliferation involved in prostate gland development;cellular response to steroid hormone stimulus;cellular response to testosterone stimulus;seminiferous tubule development;regulation of protein localization to plasma membrane;negative regulation of extrinsic apoptotic signaling pathway
- Cellular component
- nuclear chromatin;nucleus;nucleoplasm;cytoplasm;cytosol;plasma membrane;nuclear speck;protein-containing complex
- Molecular function
- RNA polymerase II proximal promoter sequence-specific DNA binding;DNA-binding transcription factor activity, RNA polymerase II-specific;RNA polymerase II transcription factor binding;RNA polymerase II general transcription initiation factor binding;DNA-binding transcription activator activity, RNA polymerase II-specific;DNA binding;chromatin binding;DNA-binding transcription factor activity;steroid hormone receptor activity;nuclear receptor activity;signaling receptor binding;steroid binding;androgen binding;protein binding;beta-catenin binding;transcription factor binding;zinc ion binding;enzyme binding;transcription regulatory region DNA binding;protein dimerization activity;ATPase binding;POU domain binding