ARHGDIA

Rho GDP dissociation inhibitor alpha

Basic information

Region (hg38): 17:81867719-81871378

Previous symbols: [ "GDIA1" ]

Links

ENSG00000141522 ∙ NCBI:396 ∙ OMIM:601925 ∙ HGNC:678 ∙ Uniprot:P52565 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• nephrotic syndrome, type 8 (Moderate), mode of inheritance: AR
• familial idiopathic steroid-resistant nephrotic syndrome (Supportive), mode of inheritance: AD
• nephrotic syndrome, type 8 (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Nephrotic syndrome, type 8	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Renal	23434736; 23867502
Renal transplant has been described

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ARHGDIA gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ARHGDIA gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				9	2	11
missense			17			17
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region				1		1
non coding		1	4	13	2	20
Total	0	1	21	22	4

Variants in ARHGDIA

This is a list of pathogenic ClinVar variants found in the ARHGDIA region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
17-81868455-C-T		ARHGDIA-related disorder	Likely benign (Dec 26, 2019)
17-81868514-C-A		Nephrotic syndrome, type 8	Benign (Jun 29, 2024)
17-81868598-AAAGGGCAGCAGAGGCCTGGCTGCGGCCTCTCTCCCCCACAGCACAGGCAGAAGCAGCAACGAGACAGGAGACCGAGGAGGCTGGGCCTGTGGGTGGGGGAGGGCTGAGGAGGGGGGTCGGAGGCACTCGGTTGAGCCAGGCCAGGGAGGCGGACCAGGGTGGGAGGGGCACGGAGGGCCTGTCAGCACTTTGGTATGGGGAGGGGAGGGGCTGGGGGGGACACATCCGCCTGTCCGTCGTCCGTCCGTCAGTCTGCCCTGCCCGCCTCTGGCTGGGCTCAGTCCTTCCAGTCCTTCTTGATGGTGAGATTCCACTCCCAGGACAGGTGGTCGGTCTTGTCGTCGTCTGTGAAGCGGGACTTGATGCTGTAGCTGCCCCGGGCCAGCATACCCTTGGGTGCCTCCTCCACGGGGGTCAGGAACTCGTACTCCTCGG-CACAGGCAGAAGCAGCAACGAGACAGGAGA			Uncertain significance (Nov 02, 2023)
17-81868633-C-T		Chronic kidney disease • Nephrotic syndrome, type 8 • ARHGDIA-related disorder	Uncertain significance (Mar 03, 2022)
17-81868659-G-A		ARHGDIA-related disorder	Likely benign (Dec 20, 2019)
17-81868668-G-C		ARHGDIA-related disorder	Likely benign (Jun 08, 2019)
17-81868708-A-G		ARHGDIA-related disorder	Likely benign (Feb 13, 2022)
17-81868708-A-AG		Nephrotic syndrome, type 8	Likely pathogenic (Mar 29, 2024)
17-81868810-T-TG		Finnish congenital nephrotic syndrome	Uncertain significance (Dec 18, 2017)
17-81868835-T-C		Nephrotic syndrome, type 8	Uncertain significance (Jul 03, 2019)
17-81868841-G-A		ARHGDIA-related disorder	Uncertain significance (Nov 29, 2023)
17-81868931-G-T		Inborn genetic diseases	Uncertain significance (Sep 19, 2022)
17-81868935-TGTC-T		Nephrotic syndrome, type 8	Pathogenic (May 01, 2013)
17-81868936-G-C		Inborn genetic diseases	Uncertain significance (Oct 05, 2021)
17-81868939-G-A			Benign (Jan 08, 2024)
17-81868942-G-A			Benign (Jan 08, 2024)
17-81868973-C-A		Nephrotic syndrome, type 8	Pathogenic (Aug 01, 2013)
17-81869017-G-A			Likely benign (Apr 27, 2023)
17-81869059-G-A		ARHGDIA-related disorder	Benign (Jan 01, 2024)
17-81869079-C-T			Likely benign (Jan 05, 2024)
17-81869087-G-A			Likely benign (Sep 21, 2022)
17-81869093-G-C			Likely benign (May 22, 2023)
17-81869153-C-T			Likely benign (Jan 04, 2024)
17-81869155-G-A			Likely benign (Jul 17, 2023)
17-81869200-G-T			Uncertain significance (Nov 02, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ARHGDIA	protein_coding	protein_coding	ENST00000269321	5	3686

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0364	0.932	125734	0	6	125740	0.0000239

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.20	87	125	0.697	0.00000748	1329
Missense in Polyphen		23	42.853	0.53672		522
Synonymous	-3.35	87	55.3	1.57	0.00000374	382
Loss of Function	1.86	4	10.5	0.380	5.75e-7	117

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000289	0.0000289
Ashkenazi Jewish	0.0000996	0.0000992
East Asian	0.000109	0.000109
Finnish	0.0000463	0.0000462
European (Non-Finnish)	0.00000879	0.00000879
Middle Eastern	0.000109	0.000109
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Controls Rho proteins homeostasis. Regulates the GDP/GTP exchange reaction of the Rho proteins by inhibiting the dissociation of GDP from them, and the subsequent binding of GTP to them. Retains Rho proteins such as CDC42, RAC1 and RHOA in an inactive cytosolic pool, regulating their stability and protecting them from degradation. Actively involved in the recycling and distribution of activated Rho GTPases in the cell, mediates extraction from membranes of both inactive and activated molecules due its exceptionally high affinity for prenylated forms. Through the modulation of Rho proteins, may play a role in cell motility regulation. In glioma cells, inhibits cell migration and invasion by mediating the signals of SEMA5A and PLXNB3 that lead to inactivation of RAC1. {ECO:0000269|PubMed:20400958, ECO:0000269|PubMed:23434736}.
• Disease: DISEASE: Nephrotic syndrome 8 (NPHS8) [MIM:615244]: A form of nephrotic syndrome, a renal disease clinically characterized by progressive renal failure, severe proteinuria, hypoalbuminemia, hyperlipidemia and edema. Kidney biopsies show diffuse mesangial sclerosis, with small glomeruli, hypercellularity, increased extracellular matrix, and contracted/collapsed glomerular tufts surrounded by immature or abnormal podocytes. {ECO:0000269|PubMed:23434736}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Neurotrophin signaling pathway - Homo sapiens (human);Vasopressin-regulated water reabsorption - Homo sapiens (human);miR-targeted genes in epithelium - TarBase;miR-targeted genes in leukocytes - TarBase;miR-targeted genes in lymphocytes - TarBase;miR-targeted genes in muscle cell - TarBase;Signal Transduction;Rho GTPase cycle;Signaling by Rho GTPases;Regulation of RAC1 activity;Death Receptor Signalling;Axonal growth stimulation;Axonal growth inhibition (RHOA activation);p75NTR regulates axonogenesis;p75 NTR receptor-mediated signalling;Regulation of CDC42 activity;PAR1-mediated thrombin signaling events;RAC1 signaling pathway;CDC42 signaling events;p75(NTR)-mediated signaling;PDGFR-beta signaling pathway;Regulation of RhoA activity (Consensus)

Intolerance Scores

• loftool: 0.222
• rvis_EVS: -0.25
• rvis_percentile_EVS: 35.42

Haploinsufficiency Scores

• pHI: 0.109
• hipred: Y
• hipred_score: 0.783
• ghis: 0.648

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.973

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Arhgdia
• Phenotype: immune system phenotype; renal/urinary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype

Zebrafish Information Network

• Gene name: arhgdia
• Affected structure: whole organism
• Phenotype tag: abnormal
• Phenotype quality: edematous

Gene ontology

• Biological process: negative regulation of cell adhesion;Rho protein signal transduction;regulation of Rho protein signal transduction;negative regulation of apoptotic process;positive regulation of GTPase activity;negative regulation of axonogenesis;positive regulation of axonogenesis;regulation of small GTPase mediated signal transduction;semaphorin-plexin signaling pathway;regulation of actin cytoskeleton reorganization
• Cellular component: cytosol;cytoskeleton;membrane;extracellular exosome
• Molecular function: Rho GDP-dissociation inhibitor activity;GTPase activator activity;protein binding;Rac GTPase binding