ARMS2

age-related maculopathy susceptibility 2

Basic information

Region (hg38): 10:122454652-122457352

Links

ENSG00000254636 ∙ NCBI:387715 ∙ OMIM:611313 ∙ HGNC:32685 ∙ Uniprot:P0C7Q2 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ARMS2 gene.

• Age related macular degeneration 8 (21 variants)
• Macular degeneration (8 variants)
• not provided (3 variants)
• Inborn genetic diseases (3 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ARMS2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			1			1
missense			4		2	6
nonsense					1	1
start loss						0
frameshift				1		1
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region				1		1
non coding			6	11	1	18
Total	0	0	11	12	4

Variants in ARMS2

This is a list of pathogenic ClinVar variants found in the ARMS2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
10-122454668-G-T		Age related macular degeneration 8	Uncertain significance (Jan 12, 2018)
10-122454719-G-A		Age related macular degeneration 8	Likely benign (Jan 13, 2018)
10-122454735-G-A		Age related macular degeneration 8	Benign (Jan 13, 2018)
10-122454750-C-T		Age related macular degeneration 8	Uncertain significance (Jan 12, 2018)
10-122454766-G-A		Age related macular degeneration 8	Uncertain significance (Jan 13, 2018)
10-122454839-C-T		Age related macular degeneration 8 • ARMS2-related disorder	Benign/Likely benign (Nov 04, 2019)
10-122454897-G-A		not specified	Uncertain significance (Mar 02, 2023)
10-122454920-A-G		not specified	Uncertain significance (Sep 20, 2023)
10-122454932-G-T		Age related macular degeneration 8 • ARMS2-related disorder	Benign (Oct 17, 2019)
10-122454959-C-G		not specified	Uncertain significance (Jun 06, 2023)
10-122454968-TTC-T			Likely benign (Sep 01, 2022)
10-122455905-C-T			not provided (-)
10-122456893-T-TG		Macular degeneration	Likely benign (Jun 14, 2016)
10-122456894-A-G		Macular degeneration • Age related macular degeneration 8	Benign/Likely benign (Jan 13, 2018)
10-122456894-A-T		Macular degeneration • Age related macular degeneration 8	Benign/Likely benign (Jan 12, 2018)
10-122456894-AT-A		Macular degeneration	Likely benign (Jun 14, 2016)
10-122456913-A-T		not specified	Uncertain significance (Aug 12, 2021)
10-122456948-A-G		Age related macular degeneration 8	Uncertain significance (Jan 12, 2018)
10-122456978-T-G		Age related macular degeneration 8	Likely benign (Jan 12, 2018)
10-122457040-T-G		Age related macular degeneration 8	Likely benign (Jan 12, 2018)
10-122457094-C-T		Age related macular degeneration 8	Likely benign (Jan 13, 2018)
10-122457137-C-A		Age related macular degeneration 8	Likely benign (Jan 12, 2018)
10-122457184-T-C		Age related macular degeneration 8	Uncertain significance (Jan 13, 2018)
10-122457246-G-C		Age related macular degeneration 8	Uncertain significance (Mar 02, 2018)
10-122457305-GTGATAGGCATTAACTAAAATTAAATAAAAATTCAGATCATCCTTGCACTTGCTGCATTTCAAATGCTTGGCAGTCACATGTAGTTAGTGGCTACCCTCTTGGACAGCACAGATAGAGATTATTTCCATCACTGCAGAAAATTCTAGACTTTGAGCTTCTTGAGGACAGGGGCTTGATCATTCGACACTGCTTTACAGTGTCTAGCAGTGTCTACCCTGTGGCAGGGGCTCAGGAAATTTTTCCTGAACCGAACCTAACTGAACTGATGTGGGTTTGTCATCAGGGTGTACCTGCTGTTAAAGGAGGTTACGACCTCTGATGCTGGGGTGGCCAGAGGGGATGGGAGTGGGTCTGGCACTCTGAGGAAAGGGGGTGAAACCAGCTGAGAAGTCATCTTTTACCTGCTGGCATGGCCCCAGCCAGGGTTCTGTTGCTATGGGAGA-TTATTAATTAATTAACTAAAATTAAATTATTTAGTTAATTTAATTAACTAAACT		Age related macular degeneration 8	risk factor (Jul 01, 2008)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ARMS2	protein_coding	protein_coding	ENST00000528446	2	2700

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000518	0.276	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.678	42	56.3	0.746	0.00000283	671
Missense in Polyphen		13	15.569	0.83498		176
Synonymous	0.401	21	23.5	0.895	0.00000126	235
Loss of Function	-0.953	4	2.40	1.66	1.01e-7	36

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

Intolerance Scores

• loftool: 0.701
• rvis_EVS: 0.72
• rvis_percentile_EVS: 85.92

Haploinsufficiency Scores

• hipred: N
• hipred_score: 0.146

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: S
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.114

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	High
Cancer	Medium	Medium	Medium

Gene ontology

• Biological process: retina homeostasis
• Cellular component: photoreceptor inner segment;mitochondrion