ARMS2
Basic information
Region (hg38): 10:122454652-122457352
Links
Phenotypes
GenCC
Source:
ClinVar
This is a list of variants' phenotypes submitted to
- Age related macular degeneration 8 (21 variants)
- Macular degeneration (8 variants)
- not provided (3 variants)
- Inborn genetic diseases (3 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the ARMS2 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 1 | |||||
missense | 6 | |||||
nonsense | 1 | |||||
start loss | 0 | |||||
frameshift | 1 | |||||
inframe indel | 0 | |||||
splice donor/acceptor (+/-2bp) | 0 | |||||
splice region ? | 1 | 1 | ||||
non coding ? | 11 | 18 | ||||
Total | 0 | 0 | 11 | 12 | 4 |
Variants in ARMS2
This is a list of pathogenic ClinVar variants found in the ARMS2 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
10-122454668-G-T | Age related macular degeneration 8 | Uncertain significance (Jan 12, 2018) | ||
10-122454719-G-A | Age related macular degeneration 8 | Likely benign (Jan 13, 2018) | ||
10-122454735-G-A | Age related macular degeneration 8 | Benign (Jan 13, 2018) | ||
10-122454750-C-T | Age related macular degeneration 8 | Uncertain significance (Jan 12, 2018) | ||
10-122454766-G-A | Age related macular degeneration 8 | Uncertain significance (Jan 13, 2018) | ||
10-122454839-C-T | Age related macular degeneration 8 • ARMS2-related disorder | Benign/Likely benign (Nov 04, 2019) | ||
10-122454897-G-A | not specified | Uncertain significance (Mar 02, 2023) | ||
10-122454920-A-G | not specified | Uncertain significance (Sep 20, 2023) | ||
10-122454932-G-T | Age related macular degeneration 8 • ARMS2-related disorder | Benign (Oct 17, 2019) | ||
10-122454959-C-G | not specified | Uncertain significance (Jun 06, 2023) | ||
10-122454968-TTC-T | Likely benign (Sep 01, 2022) | |||
10-122455905-C-T | not provided (-) | |||
10-122456893-T-TG | Macular degeneration | Likely benign (Jun 14, 2016) | ||
10-122456894-A-G | Macular degeneration • Age related macular degeneration 8 | Benign/Likely benign (Jan 13, 2018) | ||
10-122456894-A-T | Macular degeneration • Age related macular degeneration 8 | Benign/Likely benign (Jan 12, 2018) | ||
10-122456894-AT-A | Macular degeneration | Likely benign (Jun 14, 2016) | ||
10-122456913-A-T | not specified | Uncertain significance (Aug 12, 2021) | ||
10-122456948-A-G | Age related macular degeneration 8 | Uncertain significance (Jan 12, 2018) | ||
10-122456978-T-G | Age related macular degeneration 8 | Likely benign (Jan 12, 2018) | ||
10-122457040-T-G | Age related macular degeneration 8 | Likely benign (Jan 12, 2018) | ||
10-122457094-C-T | Age related macular degeneration 8 | Likely benign (Jan 13, 2018) | ||
10-122457137-C-A | Age related macular degeneration 8 | Likely benign (Jan 12, 2018) | ||
10-122457184-T-C | Age related macular degeneration 8 | Uncertain significance (Jan 13, 2018) | ||
10-122457246-G-C | Age related macular degeneration 8 | Uncertain significance (Mar 02, 2018) | ||
10-122457305-GTGATAGGCATTAACTAAAATTAAATAAAAATTCAGATCATCCTTGCACTTGCTGCATTTCAAATGCTTGGCAGTCACATGTAGTTAGTGGCTACCCTCTTGGACAGCACAGATAGAGATTATTTCCATCACTGCAGAAAATTCTAGACTTTGAGCTTCTTGAGGACAGGGGCTTGATCATTCGACACTGCTTTACAGTGTCTAGCAGTGTCTACCCTGTGGCAGGGGCTCAGGAAATTTTTCCTGAACCGAACCTAACTGAACTGATGTGGGTTTGTCATCAGGGTGTACCTGCTGTTAAAGGAGGTTACGACCTCTGATGCTGGGGTGGCCAGAGGGGATGGGAGTGGGTCTGGCACTCTGAGGAAAGGGGGTGAAACCAGCTGAGAAGTCATCTTTTACCTGCTGGCATGGCCCCAGCCAGGGTTCTGTTGCTATGGGAGA-TTATTAATTAATTAACTAAAATTAAATTATTTAGTTAATTTAATTAACTAAACT | Age related macular degeneration 8 | risk factor (Jul 01, 2008) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
ARMS2 | protein_coding | protein_coding | ENST00000528446 | 2 | 2700 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
0.000518 | 0.276 | 0 | 0 | 0 | 0 | 0.00 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 0.678 | 42 | 56.3 | 0.746 | 0.00000283 | 671 |
Missense in Polyphen | 13 | 15.569 | 0.83498 | 176 | ||
Synonymous | 0.401 | 21 | 23.5 | 0.895 | 0.00000126 | 235 |
Loss of Function | -0.953 | 4 | 2.40 | 1.66 | 1.01e-7 | 36 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00 | 0.00 |
Ashkenazi Jewish | 0.00 | 0.00 |
East Asian | 0.00 | 0.00 |
Finnish | 0.00 | 0.00 |
European (Non-Finnish) | 0.00 | 0.00 |
Middle Eastern | 0.00 | 0.00 |
South Asian | 0.00 | 0.00 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
Intolerance Scores
- loftool
- 0.701
- rvis_EVS
- 0.72
- rvis_percentile_EVS
- 85.92
Haploinsufficiency Scores
- pHI
- hipred
- N
- hipred_score
- 0.146
- ghis
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- S
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.114
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | High |
Cancer | Medium | Medium | Medium |
Gene ontology
- Biological process
- retina homeostasis
- Cellular component
- photoreceptor inner segment;mitochondrion
- Molecular function