ASPA

aspartoacylase

Basic information

Region (hg38): 17:3472373-3503405

Links

ENSG00000108381 ∙ NCBI:443 ∙ OMIM:608034 ∙ HGNC:756 ∙ Uniprot:P45381 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Canavan disease (Definitive), mode of inheritance: AR
• Canavan disease (Definitive), mode of inheritance: AR
• Canavan disease (Strong), mode of inheritance: AR
• severe Canavan disease (Supportive), mode of inheritance: AR
• mild Canavan disease (Supportive), mode of inheritance: AR
• Canavan disease (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Aspartoacylase deficiency (Canavan disease)	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic; Ophthalmologic	2512436; 8252036; 8023850; 10909858; 12638939; 16437572; 18070137

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ASPA gene.

• Spongy degeneration of central nervous system (320 variants)
• not provided (36 variants)
• Inborn genetic diseases (31 variants)
• Canavan Disease, Familial Form (26 variants)
• not specified (13 variants)
• Mild Canavan disease (2 variants)
• Abnormality of metabolism/homeostasis (1 variants)
• Intellectual disability (1 variants)
• Fraser syndrome 3 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ASPA gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				92		92
missense	10	32	55	6	1	104
nonsense	10	8	1			19
start loss		2				2
frameshift	13	30	1			44
inframe indel	1		2			3
splice donor/acceptor (+/-2bp)	3	15				18
splice region			3	9		12
non coding			5	16	12	33
Total	37	87	64	114	13

Highest pathogenic variant AF is 0.000263

Variants in ASPA

This is a list of pathogenic ClinVar variants found in the ASPA region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
17-3476008-C-T		Spongy degeneration of central nervous system	Uncertain significance (Jun 14, 2016)
17-3476055-T-C		Spongy degeneration of central nervous system	Uncertain significance (Jun 14, 2016)
17-3476154-G-A		Spongy degeneration of central nervous system	Uncertain significance (Jul 14, 2021)
17-3476161-T-C		Spongy degeneration of central nervous system	Pathogenic/Likely pathogenic (May 15, 2023)
17-3476162-G-A		Spongy degeneration of central nervous system	Pathogenic (Apr 04, 2023)
17-3476162-G-T		Spongy degeneration of central nervous system	Likely pathogenic (-)
17-3476169-T-C		Spongy degeneration of central nervous system	Likely benign (Jan 24, 2024)
17-3476169-T-GG		Spongy degeneration of central nervous system	Pathogenic (Apr 10, 2023)
17-3476174-C-T		Spongy degeneration of central nervous system	Likely benign (Aug 12, 2021)
17-3476178-GCTGAAGAACATATACAAAAGGTTGCTATCTTTGGAGGAACCCATGGGAATGAGCTAACCGGAGTATTTCTGGTTAAGCATTGGCTAGAGAATGGCGCTGAGATTCAGAGAACAGGGCTGGAGGTAAAACCATTTATTACTAACCCCAGAGCAGTGAAGAAGTGTACCAGATATATTGACTGTGACC-G		Spongy degeneration of central nervous system	Pathogenic (Oct 19, 2023)
17-3476184-G-T		Spongy degeneration of central nervous system	Pathogenic (Mar 29, 2022)
17-3476184-G-GA		Spongy degeneration of central nervous system	Pathogenic (Oct 09, 2021)
17-3476189-T-C		Spongy degeneration of central nervous system • Inborn genetic diseases	Likely benign (Dec 13, 2023)
17-3476190-AT-A		Spongy degeneration of central nervous system • Canavan Disease, Familial Form	Pathogenic/Likely pathogenic (May 23, 2022)
17-3476190-ATACAAAAGGTTGC-A		Spongy degeneration of central nervous system	Pathogenic (Jun 11, 2023)
17-3476193-C-T		Spongy degeneration of central nervous system	Pathogenic (Oct 03, 2021)
17-3476195-A-G		Spongy degeneration of central nervous system	Likely benign (Dec 22, 2019)
17-3476197-A-G		Spongy degeneration of central nervous system	Uncertain significance (Dec 31, 2021)
17-3476197-AG-A		Spongy degeneration of central nervous system	Likely pathogenic (Dec 12, 2022)
17-3476199-G-A		Spongy degeneration of central nervous system	Uncertain significance (Mar 14, 2022)
17-3476204-T-C		Spongy degeneration of central nervous system	Likely benign (Aug 14, 2020)
17-3476206-T-C		Spongy degeneration of central nervous system	Pathogenic/Likely pathogenic (Jul 09, 2023)
17-3476207-C-A		Spongy degeneration of central nervous system	Likely benign (Feb 14, 2023)
17-3476216-A-C		Spongy degeneration of central nervous system	Likely benign (Nov 22, 2018)
17-3476218-C-T		Spongy degeneration of central nervous system	Uncertain significance (Dec 11, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ASPA	protein_coding	protein_coding	ENST00000263080	6	31046

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000411	0.864	125722	0	26	125748	0.000103

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.479	154	172	0.897	0.00000913	2080
Missense in Polyphen		57	67.504	0.8444		848
Synonymous	0.404	57	61.0	0.934	0.00000356	575
Loss of Function	1.33	7	12.0	0.585	5.04e-7	165

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000152	0.000152
Ashkenazi Jewish	0.00129	0.00129
East Asian	0.00	0.00
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.0000617	0.0000615
Middle Eastern	0.00	0.00
South Asian	0.0000654	0.0000653
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Catalyzes the deacetylation of N-acetylaspartic acid (NAA) to produce acetate and L-aspartate. NAA occurs in high concentration in brain and its hydrolysis NAA plays a significant part in the maintenance of intact white matter. In other tissues it act as a scavenger of NAA from body fluids.
• Pathway: Alanine, aspartate and glutamate metabolism - Homo sapiens (human);Histidine metabolism - Homo sapiens (human);Hypoacetylaspartia;Aspartate Metabolism;Canavan Disease;Alanine and aspartate metabolism;Alanine Aspartate Asparagine metabolism;Metabolism of amino acids and derivatives;Metabolism;Amino acid synthesis and interconversion (transamination) (Consensus)

Intolerance Scores

• loftool: 0.144
• rvis_EVS: -0.12
• rvis_percentile_EVS: 45.13

Haploinsufficiency Scores

• pHI: 0.413
• hipred: N
• hipred_score: 0.231
• ghis: 0.539

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.938

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Aspa
• Phenotype: hearing/vestibular/ear phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; skeleton phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; hematopoietic system phenotype; growth/size/body region phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); muscle phenotype; homeostasis/metabolism phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan)

Gene ontology

• Biological process: aspartate catabolic process;cellular amino acid biosynthetic process;central nervous system myelination;positive regulation of oligodendrocyte differentiation
• Cellular component: nucleus;cytosol
• Molecular function: aminoacylase activity;protein binding;hydrolase activity, acting on ester bonds;aspartoacylase activity;identical protein binding;metal ion binding