Menu
GeneBe

ATXN7

ataxin 7, the group of SAGA complex

Basic information

Region (hg38): 3:63863154-64003462

Previous symbols: [ "SCA7" ]

Links

ENSG00000163635NCBI:6314OMIM:607640HGNC:10560Uniprot:O15265AlphaFoldGenCCjaxSfariGnomADPubmedClinVar

Phenotypes

GenCC

Source: genCC

  • spinocerebellar ataxia type 7 (Moderate), mode of inheritance: AD
  • spinocerebellar ataxia type 7 (Supportive), mode of inheritance: AD
  • autosomal dominant cerebellar ataxia type II (Definitive), mode of inheritance: AD
  • autosomal dominant cerebellar ataxia type II (Strong), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

ConditionInheritanceIntervention CategoriesIntervention/Rationale Manifestation CategoriesReferences
Spinocerebellar ataxia 7ADGeneralGenetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testingNeurologic; Ophthalmologic7477379; 8908515; 9288099; 9536097; 9736784; 10330346; 10453742; 11030806; 15349877; 15750685; 15747371; 20301433; 23368522

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ATXN7 gene.

  • Inborn genetic diseases (51 variants)
  • not provided (16 variants)
  • Spinocerebellar ataxia 7 (6 variants)
  • not specified (5 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ATXN7 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type Pathogenic Likely pathogenic VUS Likely benign Benign Sum
synonymous
1
clinvar
1
clinvar
1
clinvar
3
missense
56
clinvar
1
clinvar
57
nonsense
0
start loss
0
frameshift
1
clinvar
1
inframe indel
1
clinvar
1
clinvar
2
clinvar
4
clinvar
8
splice donor/acceptor (+/-2bp)
0
splice region
1
1
non coding
1
clinvar
1
clinvar
2
Total 1 0 60 5 5

Variants in ATXN7

This is a list of pathogenic ClinVar variants found in the ATXN7 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position Type Phenotype Significance ClinVar
3-63912635-C-T Uncertain significance (Sep 01, 2023)2653937
3-63912652-G-C ATXN7-related condition Likely benign (Apr 25, 2019)3046008
3-63912654-C-A Inborn genetic diseases Uncertain significance (Nov 07, 2023)3132281
3-63912677-G-A Inborn genetic diseases Uncertain significance (Jan 26, 2022)2273048
3-63912684-GGCA-G not specified Benign (-)1328067
3-63912684-G-GGCAGCA not specified Likely benign (Mar 28, 2016)402403
3-63912684-G-GGCAGCAGCA ATXN7-related condition Likely benign (Jul 03, 2020)3033271
3-63912684-G-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA Spinocerebellar ataxia 7 Pathogenic (Apr 09, 2019)626311
3-63912684-G-GGCAGCAGCAGCA Benign (Mar 01, 2024)2653938
3-63912684-G-GGCAGCAGCAGCAGCA Benign (Jul 01, 2022)2653939
3-63912699-A-C Inborn genetic diseases Uncertain significance (Mar 31, 2022)2391601
3-63912702-A-C ATXN7-related condition Likely benign (Aug 09, 2022)3057278
3-63912709-G-C Inborn genetic diseases Uncertain significance (Sep 27, 2022)2334908
3-63912708-A-AGCCGCC Spinocerebellar ataxia 7 Uncertain significance (Apr 27, 2019)638436
3-63912714-A-C Uncertain significance (Jun 01, 2016)809501
3-63912714-A-AGCC Benign (Jul 01, 2023)2653941
3-63912714-A-AGCAGCC Likely benign (Jul 01, 2023)2653940
3-63912722-C-T Inborn genetic diseases Uncertain significance (Jul 25, 2023)2602666
3-63912725-C-G Inborn genetic diseases Uncertain significance (Mar 06, 2023)2494340
3-63912741-A-G not specified Uncertain significance (Dec 26, 2023)2691398
3-63912777-C-G Inborn genetic diseases Uncertain significance (Feb 23, 2023)2488934
3-63912779-G-C Inborn genetic diseases Uncertain significance (Feb 27, 2024)3132266
3-63912789-G-C Inborn genetic diseases Uncertain significance (Feb 05, 2024)3132269
3-63912809-T-G Abnormality of neuronal migration Likely benign (Dec 01, 2023)208954
3-63912815-G-A Inborn genetic diseases Uncertain significance (Oct 13, 2023)3132273

GnomAD

Source: gnomAD

GeneTypeBio TypeTranscript Coding Exons Length
ATXN7protein_codingprotein_codingENST00000398590 12138906
pLI Probability
LOF Intolerant
pRec Probability
LOF Recessive
Individuals with
no LOFs
Individuals with
Homozygous LOFs
Individuals with
Heterozygous LOFs
Defined p
0.9600.0405124790041247940.0000160
Z-Score Observed Expected Observed/Expected Mutation Rate Total Possible in Transcript
Missense-0.6235445051.080.00002766099
Missense in Polyphen160193.10.828592347
Synonymous-0.8382212061.070.00001261974
Loss of Function4.43532.10.1560.00000163435

LoF frequencies by population

EthnicitySum of pLOFs p
African & African-American0.000.00
Ashkenazi Jewish0.000.00
East Asian0.00005560.0000556
Finnish0.00004640.0000464
European (Non-Finnish)0.000009000.00000883
Middle Eastern0.00005560.0000556
South Asian0.000.00
Other0.0001650.000165

dbNSFP

Source: dbNSFP

Function
FUNCTION: Acts as component of the STAGA transcription coactivator-HAT complex. Mediates the interaction of STAGA complex with the CRX and is involved in CRX-dependent gene activation. Necessary for microtubule cytoskeleton stabilization. {ECO:0000269|PubMed:22100762}.;
Disease
DISEASE: Spinocerebellar ataxia 7 (SCA7) [MIM:164500]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA7 belongs to the autosomal dominant cerebellar ataxias type II (ADCA II) which are characterized by cerebellar ataxia with retinal degeneration and pigmentary macular dystrophy. {ECO:0000269|PubMed:9288099}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
Pathway
Post-translational protein modification;Metabolism of proteins;Chromatin modifying enzymes;HATs acetylate histones;Ub-specific processing proteases;Deubiquitination;Chromatin organization (Consensus)

Recessive Scores

pRec
0.440

Intolerance Scores

loftool
0.381
rvis_EVS
0.21
rvis_percentile_EVS
67.5

Haploinsufficiency Scores

pHI
0.401
hipred
Y
hipred_score
0.518
ghis
0.522

Essentials

essential_gene_CRISPR
N
essential_gene_CRISPR2
N
essential_gene_gene_trap
N
gene_indispensability_pred
E
gene_indispensability_score
0.671

Gene Damage Prediction

AllRecessiveDominant
MendelianMediumMediumMedium
Primary ImmunodeficiencyMediumMediumHigh
CancerHighMediumHigh

Mouse Genome Informatics

Gene name
Atxn7
Phenotype
muscle phenotype; growth/size/body region phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; skeleton phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span);

Zebrafish Information Network

Gene name
atxn7
Affected structure
photoreceptor cell
Phenotype tag
abnormal
Phenotype quality
decreased amount

Gene ontology

Biological process
microtubule cytoskeleton organization;nucleus organization;visual perception;histone deubiquitination;protein deubiquitination
Cellular component
nucleus;nucleoplasm;nucleolus;cytosol;microtubule cytoskeleton;nuclear matrix
Molecular function
protein binding;thiol-dependent ubiquitinyl hydrolase activity