ATXN7

ataxin 7, the group of SAGA complex

Basic information

Region (hg38): 3:63863154-64003462

Previous symbols: [ "SCA7" ]

Links

ENSG00000163635

∙ NCBI:6314 ∙ OMIM:607640 ∙ HGNC:10560 ∙ Uniprot:O15265 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed

Phenotypes

GenCC

Source: genCC

spinocerebellar ataxia type 7 (Moderate), mode of inheritance: AD
spinocerebellar ataxia type 7 (Supportive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Spinocerebellar ataxia 7	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic; Ophthalmologic	7477379; 8908515; 9288099; 9536097; 9736784; 10330346; 10453742; 11030806; 15349877; 15750685; 15747371; 20301433; 23368522

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ATXN7 gene.

Inborn genetic diseases (33 variants)
not specified (10 variants)
not provided (10 variants)
Spinocerebellar ataxia 7 (6 variants)
Abnormality of neuronal migration (2 variants)
Tip-toe gait (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ATXN7 gene is commonly pathogenic or not.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			1	3		4
missense		1	37	6	2	46
nonsense						0
start loss						0
frameshift			1			1
inframe indel	1		1	1	2	5
splice variant						0
non coding				1		1
Total	1	1	40	11	4

Variants in ATXN7

This is a list of pathogenic ClinVar variants found in the ATXN7 region.

Position	Phenotype	Significance	ClinVar
3-63912677-G-A	Inborn genetic diseases	Uncertain significance (Jan 26, 2022)	link
3-63912684-GGCA-G	not specified	Benign (-)	link
3-63912684-G-GGCAGCA	not specified	Likely benign (Mar 28, 2016)	link
3-63912684-G-GGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA	Spinocerebellar ataxia 7	Pathogenic (Apr 09, 2019)	link
3-63912699-A-C	Inborn genetic diseases	Uncertain significance (Mar 31, 2022)	link
3-63912709-G-C	Inborn genetic diseases	Uncertain significance (Sep 27, 2022)	link
3-63912708-A-AGCCGCC	Spinocerebellar ataxia 7	Uncertain significance (Apr 27, 2019)	link
3-63912714-A-C		Uncertain significance (Jun 01, 2016)	link
3-63912722-C-T	Inborn genetic diseases	Uncertain significance (Jul 25, 2023)	link
3-63912725-C-G	Inborn genetic diseases	Uncertain significance (Mar 06, 2023)	link
3-63912777-C-G	Inborn genetic diseases	Uncertain significance (Feb 23, 2023)	link
3-63912809-T-G	Abnormality of neuronal migration	Benign (Oct 31, 2014)	link
3-63912828-C-G	Inborn genetic diseases	Uncertain significance (Dec 01, 2022)	link
3-63912871-G-C	not specified	Benign/Likely benign (-)	link
3-63952387-A-G	Inborn genetic diseases	Uncertain significance (May 09, 2022)	link
3-63952421-A-G	Inborn genetic diseases	Uncertain significance (May 15, 2023)	link
3-63979953-G-A	not specified • Inborn genetic diseases	Conflicting interpretations of pathogenicity (Jun 07, 2023)	link
3-63979979-C-G	Inborn genetic diseases	Uncertain significance (Dec 15, 2022)	link
3-63979999-G-A	Inborn genetic diseases	Uncertain significance (Mar 22, 2023)	link
3-63980047-T-C	Inborn genetic diseases	Uncertain significance (Aug 13, 2021)	link
3-63980049-C-G	Inborn genetic diseases	Uncertain significance (Mar 29, 2022)	link
3-63980062-C-T	Inborn genetic diseases	Uncertain significance (Apr 12, 2022)	link
3-63980105-G-C	Inborn genetic diseases	Uncertain significance (Nov 12, 2021)	link
3-63980154-C-T	Inborn genetic diseases	Uncertain significance (Nov 30, 2022)	link
3-63982196-T-G	Inborn genetic diseases	Uncertain significance (Apr 08, 2022)	link

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ATXN7	protein_coding	protein_coding	ENST00000398590	12	138906

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.960	0.0405	124790	0	4	124794	0.0000160

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.623	544	505	1.08	0.0000276	6099
Missense in Polyphen		160	193.1	0.82859		2347
Synonymous	-0.838	221	206	1.07	0.0000126	1974
Loss of Function	4.43	5	32.1	0.156	0.00000163	435

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.0000556	0.0000556
Finnish	0.0000464	0.0000464
European (Non-Finnish)	0.00000900	0.00000883
Middle Eastern	0.0000556	0.0000556
South Asian	0.00	0.00
Other	0.000165	0.000165

dbNSFP

Source: dbNSFP

Function: FUNCTION: Acts as component of the STAGA transcription coactivator-HAT complex. Mediates the interaction of STAGA complex with the CRX and is involved in CRX-dependent gene activation. Necessary for microtubule cytoskeleton stabilization. {ECO:0000269|PubMed:22100762}.;
Disease: DISEASE: Spinocerebellar ataxia 7 (SCA7) [MIM:164500]: Spinocerebellar ataxia is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA7 belongs to the autosomal dominant cerebellar ataxias type II (ADCA II) which are characterized by cerebellar ataxia with retinal degeneration and pigmentary macular dystrophy. {ECO:0000269|PubMed:9288099}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
Pathway: Post-translational protein modification;Metabolism of proteins;Chromatin modifying enzymes;HATs acetylate histones;Ub-specific processing proteases;Deubiquitination;Chromatin organization (Consensus)

Recessive Scores

pRec: 0.440

Intolerance Scores

loftool: 0.381
rvis_EVS: 0.21
rvis_percentile_EVS: 67.5

Haploinsufficiency Scores

pHI: 0.401
hipred: Y
hipred_score: 0.518
ghis: 0.522

Essentials

essential_gene_CRISPR: N
essential_gene_CRISPR2: N
essential_gene_gene_trap: N
gene_indispensability_pred: E
gene_indispensability_score: 0.671

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	High
Cancer	High	Medium	High

Mouse Genome Informatics

Gene name: Atxn7
Phenotype: muscle phenotype; growth/size/body region phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; skeleton phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span);

Zebrafish Information Network

Gene name: atxn7
Affected structure: photoreceptor cell
Phenotype tag: abnormal
Phenotype quality: decreased amount

Gene ontology

Biological process: microtubule cytoskeleton organization;nucleus organization;visual perception;histone deubiquitination;protein deubiquitination
Cellular component: nucleus;nucleoplasm;nucleolus;cytosol;microtubule cytoskeleton;nuclear matrix
Molecular function: protein binding;thiol-dependent ubiquitinyl hydrolase activity