BARD1

BRCA1 associated RING domain 1, the group of Ankyrin repeat domain containing|Ring finger proteins|BRCA1 B complex

Basic information

Region (hg38): 2:214725645-214809683

Links

ENSG00000138376 ∙ NCBI:580 ∙ OMIM:601593 ∙ HGNC:952 ∙ Uniprot:Q99728 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• hereditary breast carcinoma (Strong), mode of inheritance: AD
• hereditary breast carcinoma (Strong), mode of inheritance: AD
• hereditary breast carcinoma (Definitive), mode of inheritance: AD
• hereditary nonpolyposis colon cancer (Limited), mode of inheritance: AD
• familial ovarian cancer (Limited), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Breast cancer, susceptibility to	AD	Oncologic	Though the availability of empirical data is incomplete as applies to both screening strategies and prophylactic treatment, surveillance may allow early detection and management of cancer	Oncologic	14550946; 16768547; 16825437; 17333333; 24549055; 25058500

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the BARD1 gene.

• Familial cancer of breast (2797 variants)
• Hereditary cancer-predisposing syndrome (2343 variants)
• not provided (674 variants)
• not specified (343 variants)
• Hereditary breast ovarian cancer syndrome (80 variants)
• Malignant tumor of breast (68 variants)
• Breast and/or ovarian cancer (35 variants)
• BARD1-related condition (21 variants)
• Gastric cancer (12 variants)
• Ovarian cancer (9 variants)
• Breast neoplasm (7 variants)
• Hereditary cancer (5 variants)
• Triple-Negative Breast Cancer Finding (5 variants)
• Familial ovarian cancer (4 variants)
• Carcinoma of colon (3 variants)
• Inborn genetic diseases (3 variants)
• Breast carcinoma (3 variants)
• Familial pancreatic carcinoma (3 variants)
• Breast cancer, susceptibility to (2 variants)
• Malignant tumor of thyroid gland (1 variants)
• Lung cancer (1 variants)
• Familial adenomatous polyposis 2 (1 variants)
• Endometrial carcinoma (1 variants)
• Hepatoblastoma (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the BARD1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			10	643	3	656
missense		2	1757	16	3	1778
nonsense	82	44	2			128
start loss			2			2
frameshift	219	71	7			297
inframe indel	1		49	1		51
splice donor/acceptor (+/-2bp)	5	63	8			76
splice region		9	66	41	2	118
non coding		1	29	220	65	315
Total	307	181	1864	880	71

Highest pathogenic variant AF is 0.0000329

Variants in BARD1

This is a list of pathogenic ClinVar variants found in the BARD1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-214727991-ATGTACAGAATAAAAATATGTACCATGAGCCTAGTGTTGATTTTTACCACACACACAAAAAAACCAATGTTAATGATTAAATCACAATTTCCTGATGATATACAAGATAAAAAACAGGGATGAAAGTGTAGAAACACACAACAAAGTAAATTATTAAGAAAAGAAATGAACACAATATAGGATAAAGACAATTGCAGATAGGAGAATTTAACACCTATGGTGGCACATTTAGACCAAATACTCTTTTTTCAATAAAGCCAAAATAAATTGTTTGATAATATTCTGTTTACTAAAAAAAAAAAAAAAAAAAAGGCAAGTTTTTTCACTGGTGGCAGGTATGGAGAATATTAAAAGACTCAAACAGTAATGATACCACTTGTCTATTTAACCAAGATTCTGGTGTCCTCATTAATCTTTGATACCCAATAATCTGAATAGAAAGACATGATAAATCAAAAACATGCCAATTTTAAAAAGAAAAACCTTTAAAAGCAATCCCAGCTTCTAAATGGTAAACATAACATGAATTCCTAATCTGGCATTAGACTTTTTTTTTTTTTTTGATTCAAAGACAAATATGAATGACTCTACCTATTTGTAAAAATGTGAACATTAAAAACAGTACAATGACTGGGCTCTCACAAACCGTGCAAATTCAATTTGAAATGTTCATCTGGTATAATATTCAGC-A		Familial cancer of breast	Uncertain significance (May 06, 2019)
2-214728360-A-G			Likely benign (Apr 24, 2022)
2-214728509-T-C			Benign (Jun 22, 2018)
2-214728537-CT-C		Familial cancer of breast	Benign (Aug 09, 2019)
2-214728537-C-CT			Benign (Aug 14, 2019)
2-214728537-C-CTT		Familial cancer of breast	Benign (Aug 14, 2019)
2-214728537-C-CTTT		Familial cancer of breast	Benign/Likely benign (Aug 14, 2019)
2-214728537-C-CTTTT		Breast neoplasm	Conflicting classifications of pathogenicity (Jun 14, 2016)
2-214728552-TGA-T		Familial cancer of breast	Benign (May 28, 2019)
2-214728557-C-T		Familial cancer of breast	Benign (May 28, 2019)
2-214728638-G-A		Familial cancer of breast	Uncertain significance (Jan 13, 2018)
2-214728664-C-G		Hereditary cancer-predisposing syndrome	Uncertain significance (Mar 19, 2019)
2-214728668-T-C		Breast and/or ovarian cancer	Uncertain significance (Apr 19, 2023)
2-214728673-TATTCAGCTGTCAAGAGGAAGCAACTCAAAGGACATCACACAGTCTATAAACCAGCTCGAAGGAGCCTTCCAGACTTTGCCCTGCCGAACCCTCTCTGGGTGATAATTACACAAATCTTCATAGATGATATACTGTGTGCAGAAGCGCTGATCAGAATCGGGTCTCGCATGGTATGCGACTGTATTGATGGTCTGAGTCACGTCACTGTCTGGCTTGGGCTTTCTACTGAGGATCTGGCCCCCACCTGCAGTGACGAGCTTAATAAGGTTGTCCTTTGGATGGTGTTTGAAGGTTCCCCACAAATAGAAGTAGCATCCATCAAACAGCTTTGGCAACTGAAATAATGAGAAAACATTTGTTAAAGGCAGATCAAAATACTGTATTCAAAAACACTGTATATGAATGAGGAAAATAAAAATACAAGTTGAATATCCCTTACCTGAAACATTTGGAGGAGAAGCATTTCAGATTCATAAATTTTTTGGGTTTTGGAAAATTTGCATATACATGAGGTATCTTAAGGATGAGGCTCAAGCCTAAACACAAAATTCGTTTGTTTCTTGTACACCTTATGCACATAGCCTGAAGTAATTTTATACAATATCTTCAGTAATTTTGTGCATGAAACAAAATTTTGACTGTGTTCTGACCGTGACCTGTCACATGAGGTCAGGTGTGGAATTTTCCACTTGTGGCATCATGTCAAAGCTCAAAAAGTTTTGGATTTTGGAGCATTTTAGATGTTGGATTAGGAATGCTCCATCTGTAACAATTATGAGCAGCTAAGAAGCTACTTAATGAGGTGCTGGGACAAGTTATATTTCAAGCATACTAACTGGATCAAGAAAAATACTTAGGCAAATAGGGGCTTCCTATTTACAATTTTTTCCCTAAGATTCAGTCACCATCTCGGTTCCTTTTCACTCTTCTAAAATTTTAGATATGCTTGGTATAAAGAAAAAAACAAACTATTCATCAAACTTTTTTCATCAGGATGTTTATGCTTATTTGGTGGGACTTAAAGCCTCCACAACTCCTAGCTTATTTGAAATAGGCTTCAGAGACACCAGGCTAAACATTATTAAATTACAAGAGTAACATCTTTTCCGTGGACTTTTATCCAATTCTGCCCATCCACATTCAGGTCCTTACATATTACCAACCTAAGGTCTCCAGGGCAGCCACCATGGGGGTGTGCCCTCCAGGGTTCCAGAAATGTATTCACGGGGCACAAAAGATTTTTGTGCTGAGGCTAGGGATCCAATTAGCTATGAAACATACTTCCGTATGCTCGTTGGAAATAAAAAAAGTTTCATAATTCCCTTCTATGGAAATTTTCTTTGTGACTTCTAATATACTTATATAATATCAACAGGATAATGCGATATTATCCATTAAAGCTACAATATGTGGCCATAGAGACATATGGTAACTAAATCCAAGCAGCAGCTGTAAGTCTTCTTTCAAGCTACTTCCTGTATCTGAGATTTACCTCAGATTCTGAAAGGTTTATGGCAATGTTCAAGATGCCAAAAATCCATTAACAGTATGAAATTATTACCTTCTGGATTTTACTGCTCATCGTGATCATCTTTCAGAATCAAGTGCTTGAAATAAGCACAATTAAAATTTTAATCAGTCACCTGTAGCTGTTGAAAGGGCAGAAGTTCTTCCTGATGGTGATAATAATAGTATGTCATAATAAGAACAATGAAAGTTGTATTAAAAGAAAAATACCAGCTGTTCTCTGTTGAGCCTGCTTCTGCGTGGACCTTCAGGAATTTCATACTTTTCTTCCTGTTCACATACTTTTCTTCGTAGACATGCTTTTACCCCTGACAAAAACACAAGAATTAAAGCAAACTAAGTATCAAGTGAGCACTATATCTCTCTCATTAAAATCAAGCAATTTACCTAAGTGGTTTTTCTTCTTCATGGCAGTTTTTAAGTATTATTCTAAAATGCAAACAGAAATCTTACTTATGCCAAAACAAAATGTAATACAACTGGTTTTCCCATATAAAGAAAATATTTTAAAAAACTCTTTCTTTGGAGGATTAAGCCATAAGTTAGTACTGAACACTAACTGTAATTTTAATCTCCTTTCTGAAAAACCTAAGCCAGGATACTATTTCAAAGACAAAAATAAAAGTCTACATTTCCACTCATAGCAATTACCCAAAATTAAGGTGAATAAAAAGTCCATGACACAATAACCTAAACTGAGCACTTACCATCTATACTGCTCATTTTGACAGTTATATGTCTAATCGTCTGTTAAACTGTAAGTGATTTGACATGAAGGAATGTGCTTTAGTCTACAGCACCAAGCTCAGC-T		Malignant tumor of breast	Pathogenic (-)
2-214728676-T-C		Hereditary cancer-predisposing syndrome • Familial cancer of breast	Uncertain significance (Sep 29, 2023)
2-214728676-T-G		Hereditary cancer-predisposing syndrome	Uncertain significance (Jun 20, 2019)
2-214728677-C-G		Hereditary cancer-predisposing syndrome • Familial cancer of breast	Uncertain significance (Sep 13, 2023)
2-214728677-C-T		Hereditary cancer-predisposing syndrome • not specified • Familial cancer of breast	Conflicting classifications of pathogenicity (Oct 15, 2022)
2-214728678-A-G		Hereditary cancer-predisposing syndrome	Uncertain significance (Oct 27, 2014)
2-214728679-G-A		Familial cancer of breast • Hereditary cancer-predisposing syndrome	Likely benign (Dec 07, 2023)
2-214728679-G-C		Familial cancer of breast	Uncertain significance (Aug 20, 2023)
2-214728680-C-T		Familial cancer of breast	Uncertain significance (Oct 22, 2023)
2-214728681-T-G		Familial cancer of breast	Uncertain significance (Nov 03, 2018)
2-214728682-G-A		Familial cancer of breast • Hereditary cancer-predisposing syndrome	Likely benign (Dec 11, 2023)
2-214728684-C-G		Familial cancer of breast	Uncertain significance (Mar 23, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
BARD1	protein_coding	protein_coding	ENST00000260947	11	84059

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
1.38e-24	0.000306	125673	0	75	125748	0.000298

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.548	447	416	1.08	0.0000206	5097
Missense in Polyphen		103	121.32	0.84901		1463
Synonymous	-1.12	172	154	1.11	0.00000787	1472
Loss of Function	-0.153	36	35.0	1.03	0.00000180	451

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000516	0.000516
Ashkenazi Jewish	0.00	0.00
East Asian	0.000554	0.000544
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.000397	0.000396
Middle Eastern	0.000554	0.000544
South Asian	0.000196	0.000196
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: E3 ubiquitin-protein ligase. The BRCA1-BARD1 heterodimer specifically mediates the formation of 'Lys-6'-linked polyubiquitin chains and coordinates a diverse range of cellular pathways such as DNA damage repair, ubiquitination and transcriptional regulation to maintain genomic stability. Plays a central role in the control of the cell cycle in response to DNA damage. Acts by mediating ubiquitin E3 ligase activity that is required for its tumor suppressor function. Also forms a heterodimer with CSTF1/CSTF-50 to modulate mRNA processing and RNAP II stability by inhibiting pre-mRNA 3' cleavage. {ECO:0000269|PubMed:12890688, ECO:0000269|PubMed:14976165, ECO:0000269|PubMed:20351172}.
• Pathway: Homologous recombination - Homo sapiens (human);Integrated Breast Cancer Pathway;Retinoblastoma (RB) in Cancer;HDR through Single Strand Annealing (SSA);HDR through Homologous Recombination (HR) or Single Strand Annealing (SSA);DNA Repair;Gene expression (Transcription);Nonhomologous End-Joining (NHEJ);DNA Double-Strand Break Repair;brca1 dependent ub ligase activity;Generic Transcription Pathway;Homology Directed Repair;Post-translational protein modification;Metabolism of proteins;RNA Polymerase II Transcription;G2/M DNA damage checkpoint;G2/M Checkpoints;Cell Cycle Checkpoints;Metalloprotease DUBs;UCH proteinases;Deubiquitination;Regulation of TP53 Activity through Phosphorylation;Regulation of TP53 Activity;Transcriptional Regulation by TP53;Cell Cycle;Recruitment and ATM-mediated phosphorylation of repair and signaling proteins at DNA double strand breaks;DNA Double Strand Break Response;BARD1 signaling events;Processing of DNA double-strand break ends;Presynaptic phase of homologous DNA pairing and strand exchange;Homologous DNA Pairing and Strand Exchange;Resolution of D-loop Structures through Holliday Junction Intermediates;Resolution of D-loop Structures through Synthesis-Dependent Strand Annealing (SDSA);Resolution of D-Loop Structures;HDR through Homologous Recombination (HRR) (Consensus)

Recessive Scores

• pRec: 0.282

Intolerance Scores

• loftool: 0.859
• rvis_EVS: 0.94
• rvis_percentile_EVS: 89.86

Haploinsufficiency Scores

• pHI: 0.722
• hipred: Y
• hipred_score: 0.566
• ghis: 0.461

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: E
• essential_gene_gene_trap: E
• gene_indispensability_pred: E
• gene_indispensability_score: 0.582

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	High	Medium	High
Primary Immunodeficiency	High	High	High
Cancer	High	High	High

Mouse Genome Informatics

• Gene name: Bard1
• Phenotype: growth/size/body region phenotype; cellular phenotype; normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); neoplasm; embryo phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan)

Gene ontology

• Biological process: DNA double-strand break processing;tissue homeostasis;DNA replication;double-strand break repair via nonhomologous end joining;cellular response to DNA damage stimulus;cell cycle arrest;protein ubiquitination;protein deubiquitination;negative regulation of mRNA 3'-end processing;regulation of phosphorylation;positive regulation of apoptotic process;negative regulation of apoptotic process;positive regulation of protein catabolic process;negative regulation of protein export from nucleus;protein K6-linked ubiquitination
• Cellular component: ubiquitin ligase complex;nucleus;nucleoplasm;cytoplasm;nuclear speck;BRCA1-BARD1 complex;cytoplasmic ribonucleoprotein granule;BRCA1-A complex
• Molecular function: RNA binding;ubiquitin-protein transferase activity;protein binding;kinase binding;protein homodimerization activity;metal ion binding;protein heterodimerization activity