Menu
GeneBe

BMP15

bone morphogenetic protein 15, the group of Bone morphogenetic proteins

Basic information

Region (hg38): X:50910734-50916641

Links

ENSG00000130385NCBI:9210OMIM:300247HGNC:1068Uniprot:O95972AlphaFoldGenCCjaxSfariGnomADPubmedClinVar

Phenotypes

GenCC

Source: genCC

  • ovarian dysgenesis 2 (Moderate), mode of inheritance: AD
  • 46 XX gonadal dysgenesis (Supportive), mode of inheritance: AD
  • ovarian dysgenesis 2 (Strong), mode of inheritance: XL

Clinical Genomic Database

Source: CGD

ConditionInheritanceIntervention CategoriesIntervention/Rationale Manifestation CategoriesReferences
Ovarian dysgenesis 2XLObstetricGenetic knowledge may allow reproductive capabilities such as via egg preservationEndocrine; Genitourinary; Obstetric15136966; 16508750; 19263482

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the BMP15 gene.

  • Ovarian dysgenesis 2 (24 variants)
  • not provided (12 variants)
  • Inborn genetic diseases (11 variants)
  • not specified (7 variants)
  • Premature ovarian failure 4 (3 variants)
  • Ovarian dysgenesis (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the BMP15 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type Pathogenic Likely pathogenic VUS Likely benign Benign Sum
synonymous
2
clinvar
3
clinvar
5
missense
4
clinvar
13
clinvar
6
clinvar
2
clinvar
25
nonsense
1
clinvar
1
start loss
0
frameshift
1
clinvar
1
inframe indel
1
clinvar
1
splice donor/acceptor (+/-2bp)
0
splice region
0
non coding
3
clinvar
3
Total 5 0 14 8 9

Highest pathogenic variant AF is 0.0000802

Variants in BMP15

This is a list of pathogenic ClinVar variants found in the BMP15 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position Type Phenotype Significance ClinVar
X-50910734-GTCCCTTGGGCTTGTGTTGGGGCCTGTTGTTGAACACTAAGCCTTTCAAGATGGTCCTCCTCAGTATTCTTAGAATTCTTTTTCTTTGTGAACTCGTGCTTTTCATGGAACACAGGGCCCAAATGGCAGAAGGAGGGCAGTCCTCTATTGCCCTTCTGGCTGAGGCCCCTACTTTGCCCCTGATTGAGGAGCTGCTAGAAGAATCCCCTGGCGAACAGCCAAGGAAGCCCCGGCTCCTAGGGCATTCACTGCGGTACATGCTGGAGTTGTACCGGCGTTCAGCTGACTCGCATGGGCACCCTAGAGAGAACCGCACCATTGGGGCCACCATGGTGAGGCTGGTGAAGCCCTTGACCAATGTGGCAAGGCCTCACAGAGGTGAGTTGTTATGCCCCCATACTGCCCTGGAAGGGAGAGAAGTGGAGAGGAGTGTAGAGAAAAGGGAATTGGTGGGTTTACTGTCAGGCTTTGTTGCCTTGTGGGCAGGTTGTTTCTTTAGGCTTGGTTTTCAAAGGATGGCAAGCTTTGGAGAAGCCAGCGCCAAGCCTACTTCCCTTTAGGGCATCAACTTAAGAACAGATTGCCTTGGTGCCTACTGAGAAATCTTTCCCAGGCCCCAGGACAACTGAGTGATGTGCCATCACCTATCTTTCACAGAAACTTTTATTGCTTGTGATAGTTCTGAAAACTGTAGAGACATATCCAGCTATATTCTTGTGGAGGGCTATTTAAGTGGCGTTTTGCTCTTAGAGTACAGCTTGCTGAGTTGGGGAAACTTATAAGGCCTCAGAAAGGACATAAATAAGCTTACATCTGAGGGTCTGTATACCTGGCTCTGTGAACATGTGCTACTGTATTTCTTAATGAAAGCTACTATCTTAACTGTCTTGATGCAATTAGCCTAATTTTAAAACTAAGGCACGGAGAGGTTAAGTAACTTGCAAATGGTACACAGATAGTGGGTCGCAGAGATGGGATTGCAGCTGAAGTCTGTCTGATTCTAAAGTCTGTCGGTAACTTCTTAAGTCTTTAAATGCAGTATTCCAATATCCTTGTACCCCCAATAGTTTTTCTACTTGGGCCATATTGCTACTTTGGGATTCTGGGACTAAGTGTATTTTGGAACTTTTTTTTGTCCCCATCATGCTTGATTTTGCTTTTAACATTTGCATCAGACATTGTTGCAGGACAACAGTGGGCTATTGAAGTGTAGGACTCTCTAGAGAATGCAGACAGTCATCAACTTCAAGGAATTCTTGGGAACCTAGTGAGATCAATCTGTAGCCTTCACTAGTCTGAGATGAAAAGGGACAGGACTTAATCCCCTCCCCAAGCAAAACAATAAATATTCTCGTACCTAACCCTTACTGTGAGATTACTGTGTGCCAGGCATTGCACAAAATGTTTTATAAACATTATCTTAATCCTCACAACTACCAGATTAGGTAGTATTAACATGCCTACTTGATAGGTGAAGAAACTGAGGATCAGAGTCACTTACCCATGTCATACAACCAGTAATTGCTAGAGCCAGGTATCAAACCCAGGCTCTCAGGCCCAAAGCCTGTGTGTTAATCATCTTGCTGTTCTGACTCCCCACTGGATTTTAATTGAGTGCCAGGCAGTGTGTTTGGGTTGGGTATATAGAAGCAAATACTTTTCCGACCTCTAGAAGTTCCCAGTATAGTGGAATGGATAGATAATTACATAATAATGTTACAGTATGCCAAGTGCTTTGGAAAGGACAAACAGTAGGGCTCCCAGGACCTATGAGAAGAAATGGCTCATTTCTTGAAGTGAAGAGACTGTTGGAAGGCCTCATGGAGGAGGTAGTACTTGAAACTGACCTTGCAGAAGGAGCAAAGAGGTCATGCATTGAGGCAGATAAGTGCATTCTGATTTAGGAAAGAGAAAATGGTGTGGGTAGAGATTCATTGAACAAATATTAGGTGCCAAATGTTGGCACCTACTGAGTACTAGGCATACAGATGTGATCAAGATAGGTAAAACCCCTACTTTCATGGAACATATGTTCTCGTAGGGGAGACAAATAAGCACACACAGTTAAATTGTGAATTGTGGTAAGTGCTATCAAAGGATGAAGTAGGTTGTTAAGATAGAGAATGGCAATGAAACCTTCCCTTTCCATGGACTTGTCAGGGAATGTATCTTTGAAGAAGTGCCATTTGAGCTCAGGTCTATAAGATAAACTAGGCATGAGAAGAGTAGGGAGAAGCCTGATTTAGGCAGAGGAACAACAGGTGCAAATGCCTAGAGGGTGAAAACAAGTTGGTTCCAATTGAAGAACAGAGGAAAATCAGTATGGCTGGATCCTCATGAGCATTGTGGGAAATGGCAGGGTATGAGGCTAATGAGAAGCAGGGACTTGTAGGCTGTGATAAGGGATCTGGATCCTAAGAGCAGCAGAAAGTTGCAAAAAATCAAGCACTTTGGGAGGCCAATATGGGAAGATCACTTGAGCCCAGGAGACTGAGACCAGCCTGAGCAACACAGGGAGACATGTCTCTACAAAAAATAAAAATACATTAGCTGGGTGTAGTGGTGCACACCTGTGGTCCCAGCTACTCACGAGGCTGAGACCAGAGGATCATTTGAGCCTGGGAGGTTGAGACTAGAGGAACATTTGAGCCTGGGAGGTTGAGATTGCAGTGAGGCATGATTGTGCCACTGCACTCCAGCCTGGGTGACAGTGAGGCCCTGTCTCAAGGAAAAAAAACAACAACCCCACAAATTAAGAAAAAATTAGGCTTGTACAGATGATGTGAGGCTAGAAAGGAGGATGCCTAGAATTAGACATGTATCCTGGTCTCACTGTGGAATATACTGGTATCTAGGGACTGTGGAAAGGATCCAGAGACAGATGACAGGTTCAATCACACAGGATGTGTGATTCAGCCCTTTCCCTGAAAAGCTTTGACCAGACCCTTCCTGGCTCTGATTCTTAGCAACCCCATCCTGCTTCAGGAAACATGTGATGTCAAGGTCTCAAAGAAAAGGGCAGTTCCTCCCCAGACAGCCTGCTAGAGGTTTGGGTTGAGTTCCTTTATAGCCAGGGTGGAGCAGGTTTAAGGGTGGGCCTCTAAGAAAGATTACTGTAAGATGGGAGTGTGGAATAACTTGAGAAAGCAAATACAAGCCTGGCTTGGATTTGTGTGAATAATGTCTAGTGCGCCAAGCCCAAGGGTATATTAAGCATGAGTTGGAATTTGACCTTTTATTTTACTTATTTTTTTGAGATGGAGTTTCGCTCTTATCATCCAGGCTGGAGTGCAGTGGCACAAACTCGGCTCACTACAACCTCTGCCTCCCGGGTGCACGCCATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGTGCCTGCCACCACGCCCGGCTAATTTTTTGTATTTTTAGTAGAGGCAGGGTGTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATCCGCCCGCCTCAGACTCCCAAAGTGCTGGGATTAGAGGCGTGAGCCACCGCGCCCAGCCGGAATTTGAACTTTTAAAGATATTCTGGGGCTGGGTGCAGTGGCTCAAAGGGCGGCTAATCCCTGCACTTTGGGAGGCCAAAGGGGGCAGATCGCTTGAACCCAGGAGTTCGAGACCAGCCCGGCAACATGGCAAAACCCTGTCTCTACAAAAAACAAAACAGAAAAAGCTGGGCATGTTGGCACATACCTGTAGTCCTTGCTATCCATGGGGGCTGAGGTGAGAGGATCTCTTGAACCTGGGAAGTCAAGGCTGTAGTGAGCCATGATTGTGCCACTGTACTCCAGCCTGGGTGACAGAGGGAGACTCTGGAAAAAAAAATTCTGGAACATCAAGATGTAAAAGAACTTCTGTGTTAAAAATGCCACATCTAATGAAGAATTCCAGGCTTGTGGATTCAGTGGAGAAGAAGGACTAGGTGAATAAATACAAATTAACATGGAATTATTTACTGATAAGATGTCTGAAGATGAGAGGTGGCTTTTTCCTGTGGTGCCAGGCTTTTGTAATCTTTGCTCTTGACCTTCGCCGGGAGGGGGTGCAGAAGTTTGGAGCACCATGGATGTAACCTTTCAATCCTTTGGCCGTTGAGTGTCAGCACTACAGTTTGGATTAAAGCTCTTATTCACAAAGCAGCATCCAGCTTTTAGTAGACTTCTCAGCAAACAAAATATTTATGTGATCAAGACTGTGTTGAAAATAGTATATAGAGGAATAGTGGTAAAATGAATGGGGTAAATGGAGAACAATTTCCAGCAAGGAGTGGTAAAGAGAGAGATTAAGGGCCAAAGGAGGAAAAGATGCTTAAGAAGCAATTCTTGAAGTAGATGGAAGGCAGAAGTGGTAAGATAGCTGTCTGTACTAGAGGATGATAGACAAAATTATTTTGTAGTGCCTTGGTCCTGAGTTTGAAATTATAGCAGGCCATAGCACCCAATACTGAATTGTTGTCCCAAAGCTGCATCTGTATAGTGATATGACATGAGACTCTTTCTTAATCCATGTATGTTTCAACAATTCTAAATGGACACATTTAATGGTCAACTAATAATAATATTGATCTTCTCCCCTACATACAGTATGCACACAAGATAATTCTATATTTGAGTTTTTTCCCCCGAGCCCAGCACTGTAAGTAATCTAACAGTGAGACAGTTTCTCTTAAGAAAAACAGACTTGGGTTCAAATCTTAACTCTACCACATACCAGCTGTGTGTCCTTTGTCATAGCTTCTCTGAGCCTCAATTTCCTTATCTGCAAAATGGGGATAATAACTATCTCATAAGACTATTAAGAATTAAAGAGCTAATACATGTAAAGCATCTAGTGTATTAGTAAGTGCTCAGTAAATGATAGTATCATTATCTTGAGTTAATTTTAGGGCTGATTATAGCTATCAGTCTATATCAAGACAGTTTATGAGGAATATTCATGTTAAGAGGTAAGAAGCTAAACCTCTGCTCTTGTTCCCTCTTACTTCTGCAGGTACCTGGCATATACAGATCCTGGGCTTTCCTCTCAGACCAAACCGAGGACTATACCAACTAGTTAGAGCCACTGTGGTTTACCGCCATCATCTCCAACTAACTCGCTTCAATCTCTCCTGCCATGTGGAGCCCTGGGTGCAGAAAAACCCAACCAACCACTTCCCTTCCTCAGAAGGAGATTCCTCAAAACCTTCCCTGATGTCTAACGCTTGGAAAGAGATGGATATCACACAACTTGTTCAGCAAAGGTTCTGGAATAACAAGGGACACAGGATCCTACGACTCCGTTTTATGTGTCAGCAGCAAAAAGATAGTGGTGGTCTTGAGCTCTGGCATGGCACTTCATCCTTGGACATTGCCTTCTTGTTACTCTATTTCAATGATACTCATAAAAGCATTCGGAAGGCTAAATTTCTTCCCAGGGGCATGGAGGAGTTCATGGAAAGGGAATCTCTTCTCCGGAGAACCCGACAAGCAGATGGTATCTCAGCTGAGGTTACTGCCTCTTCCTCAAAACATAGCGGGCCTGAAAATAACCAGTGTTCCCTCCACCCTTTCCAAATCAGCTTCCGCCAGCTGGGTTGGGATCACTGGATCATTGCTCCCCCTTTCTACACCCCAAACTACTGTAAAGGAACTTGTCTCCGAGTACTACGCGATGGTCTCAATTCCCCCAATCACGCCATTATTCAGAACCTTATCAATCAGTTGGTGGACCAGAGTGTCCCCCGGCCCTCCTGTGTCCCGTATAAGTATGTTCCAATTAGTGTCCTTATGATTGAGGCAAATGGGAGTATTTTGTACAAGGAGTATGAGGGTATGATTGCTGAGTCTTGTACATGCAGATGACAGCAACAGTACGGCTAGATCAGGTTTCCCAGGA-G Ovarian dysgenesis 2 Pathogenic (Dec 01, 2019)973167
X-50910775-C-G not specified • Ovarian dysgenesis 2 Benign (Jan 12, 2018)136522
X-50910796-A-C not specified • Ovarian dysgenesis 2 Benign/Likely benign (May 28, 2019)259774
X-50910802-C-G Inborn genetic diseases Uncertain significance (Dec 08, 2021)2396286
X-50910806-G-T Inborn genetic diseases Uncertain significance (Nov 17, 2022)2326363
X-50910868-G-A Inborn genetic diseases Likely benign (Mar 29, 2023)2531359
X-50910945-C-T Ovarian dysgenesis 2 Benign/Likely benign (Jul 01, 2022)914978
X-50910949-C-T Pathogenic (Jun 27, 2022)2078651
X-50910985-C-T Premature ovarian failure 4 • Ovarian dysgenesis 2 • BMP15-related condition Conflicting classifications of pathogenicity (Sep 14, 2023)11474
X-50910991-A-C Genetic non-acquired premature ovarian failure Likely pathogenic (Oct 01, 2019)1256010
X-50911009-C-T Premature ovarian failure 4 • Ovarian dysgenesis 2 Conflicting classifications of pathogenicity (May 04, 2022)11471
X-50911045-C-T Inborn genetic diseases Uncertain significance (Feb 26, 2024)3134510
X-50911052-T-C Inborn genetic diseases Uncertain significance (Jul 27, 2021)2239510
X-50911091-A-G not specified • Ovarian dysgenesis 2 Benign (Jul 14, 2021)136523
X-50915683-A-C Benign (Oct 31, 2018)1292837
X-50915837-T-A BMP15-related condition • Inborn genetic diseases Conflicting classifications of pathogenicity (Jan 23, 2024)3049277
X-50915841-G-A Ovarian dysgenesis 2 Pathogenic (May 04, 2022)1685573
X-50915871-T-C Ovarian dysgenesis 2 Benign/Likely benign (Dec 31, 2019)368538
X-50915887-GC-G Ovarian dysgenesis 2 Likely pathogenic (Dec 01, 2019)973166
X-50915948-C-T Ovarian dysgenesis 2 Likely benign (Apr 28, 2017)914979
X-50915957-A-T Inborn genetic diseases Likely benign (Mar 02, 2023)2493163
X-50915966-G-A Premature ovarian failure 4 • Ovarian dysgenesis 2 Conflicting classifications of pathogenicity (May 28, 2019)11472
X-50916009-T-C Ovarian dysgenesis 2 • BMP15-related condition Benign/Likely benign (Apr 01, 2023)368539
X-50916018-A-T Inborn genetic diseases Uncertain significance (Jan 03, 2024)3134511
X-50916021-AG-A Ovarian dysgenesis 2 Uncertain significance (Sep 12, 2017)632053

GnomAD

Source: gnomAD

GeneTypeBio TypeTranscript Coding Exons Length
BMP15protein_codingprotein_codingENST00000252677 25824
pLI Probability
LOF Intolerant
pRec Probability
LOF Recessive
Individuals with
no LOFs
Individuals with
Homozygous LOFs
Individuals with
Heterozygous LOFs
Defined p
0.0001830.7221257074111257220.0000597
Z-Score Observed Expected Observed/Expected Mutation Rate Total Possible in Transcript
Missense0.06991571590.9840.00001272547
Missense in Polyphen3436.9630.91984606
Synonymous0.06095656.60.9900.00000405794
Loss of Function0.948710.30.6818.83e-7143

LoF frequencies by population

EthnicitySum of pLOFs p
African & African-American0.0001880.000160
Ashkenazi Jewish0.000.00
East Asian0.000.00
Finnish0.000.00
European (Non-Finnish)0.0001370.0000967
Middle Eastern0.000.00
South Asian0.00005240.0000327
Other0.000.00

dbNSFP

Source: dbNSFP

Function
FUNCTION: May be involved in follicular development. Oocyte- specific growth/differentiation factor that stimulates folliculogenesis and granulosa cell (GC) growth. {ECO:0000269|PubMed:18227435}.;
Disease
DISEASE: Ovarian dysgenesis 2 (ODG2) [MIM:300510]: A disorder characterized by lack of spontaneous pubertal development, primary amenorrhea, uterine hypoplasia, and hypergonadotropic hypogonadism as a result of streak gonads. {ECO:0000269|PubMed:15136966}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Premature ovarian failure 4 (POF4) [MIM:300510]: An ovarian disorder defined as the cessation of ovarian function under the age of 40 years. It is characterized by oligomenorrhea or amenorrhea, in the presence of elevated levels of serum gonadotropins and low estradiol. {ECO:0000269|PubMed:16464940, ECO:0000269|PubMed:16508750, ECO:0000269|PubMed:16645022, ECO:0000269|PubMed:19263482, ECO:0000269|PubMed:19438907}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
Pathway
Ovarian steroidogenesis - Homo sapiens (human);TGF-Core;Post-translational protein phosphorylation;Post-translational protein modification;Metabolism of proteins;GPCR signaling-G alpha q;GPCR signaling-cholera toxin;GPCR signaling-pertussis toxin;TGF-beta super family signaling pathway canonical;Regulation of Insulin-like Growth Factor (IGF) transport and uptake by Insulin-like Growth Factor Binding Proteins (IGFBPs);GPCR signaling-G alpha s Epac and ERK;GPCR signaling-G alpha s PKA and ERK;GPCR signaling-G alpha i;BMP2 signaling TGF-beta MV;BMP signaling Dro (Consensus)

Recessive Scores

pRec
0.191

Intolerance Scores

loftool
0.215
rvis_EVS
0.6
rvis_percentile_EVS
82.66

Haploinsufficiency Scores

pHI
0.413
hipred
N
hipred_score
0.229
ghis

Essentials

essential_gene_CRISPR
N
essential_gene_CRISPR2
N
essential_gene_gene_trap
N
gene_indispensability_pred
N
gene_indispensability_score
0.223

Gene Damage Prediction

AllRecessiveDominant
MendelianMediumMediumMedium
Primary ImmunodeficiencyMediumMediumMedium
CancerMediumMediumMedium

Mouse Genome Informatics

Gene name
Bmp15
Phenotype
reproductive system phenotype; endocrine/exocrine gland phenotype;

Zebrafish Information Network

Gene name
bmp15
Affected structure
ovarian follicle
Phenotype tag
abnormal
Phenotype quality
maturity

Gene ontology

Biological process
ovarian follicle development;female gamete generation;regulation of signaling receptor activity;positive regulation of pathway-restricted SMAD protein phosphorylation;BMP signaling pathway;regulation of apoptotic process;regulation of MAPK cascade;post-translational protein modification;cellular protein metabolic process;positive regulation of transcription, DNA-templated;cell development;granulosa cell development;SMAD protein signal transduction
Cellular component
extracellular space;endoplasmic reticulum lumen
Molecular function
cytokine activity;transforming growth factor beta receptor binding;growth factor activity