BMPR1A
bone morphogenetic protein receptor type 1A, the group of Type 1 receptor serine/threonine kinases|CD molecules
Basic information
Region (hg38): 10:86755786-86932825
Previous symbols: [ "ACVRLK3" ]
Links
Phenotypes
GenCC
Source:
- polyposis syndrome, hereditary mixed, 2 (Strong), mode of inheritance: AD
- generalized juvenile polyposis/juvenile polyposis coli (Strong), mode of inheritance: AD
- juvenile polyposis syndrome (Strong), mode of inheritance: AD
- generalized juvenile polyposis/juvenile polyposis coli (Definitive), mode of inheritance: AD
- hereditary mixed polyposis syndrome (Supportive), mode of inheritance: AD
- generalized juvenile polyposis/juvenile polyposis coli (Supportive), mode of inheritance: AD
- juvenile polyposis syndrome (Definitive), mode of inheritance: AD
- pulmonary arterial hypertension (Disputed Evidence), mode of inheritance: Unknown
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Polyposis syndrome, hereditary mixed, 2; Polyposis, juvenile intestinal | AD | Oncologic | Surveillance (eg, with colonoscopy and endoscopic polypectomy, as well upper endoscopy for symptomatic individuals, and monitoring for sequelae including anemia and rectal bleeding) may be beneficial, though partial/total colectomy/gastrectomy may be indicated in some individuals with a large polyp burden; Indivduals may have a variety of HHT-related vascular complications, including arteriovenous malformations, aortic dilatation, and bleeding diatheses, and surveillance and early intervention related to manifestations (eg, related to thromboembolism or hepatic disease) may decrease morbidity and mortality | Oncologic | 5483654; 4544011; 7059958; 3707330; 8037173; 7582207; 11381269; 12136244; 15235019; 16152648; 16525031; 17873119; 20843829; 22171123; 22810475 |
ClinVar
This is a list of variants' phenotypes submitted to
- Juvenile polyposis syndrome (136 variants)
- Hereditary cancer-predisposing syndrome (83 variants)
- not provided (15 variants)
- Generalized juvenile polyposis/juvenile polyposis coli (11 variants)
- Polyposis syndrome, hereditary mixed, 2 (3 variants)
- Juvenile polyposis syndrome;Polyposis syndrome, hereditary mixed, 2 (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the BMPR1A gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 380 | 383 | ||||
| missense | 14 | 897 | 914 | |||
| nonsense | 55 | 63 | ||||
| start loss | 6 | |||||
| frameshift | 115 | 15 | 136 | |||
| inframe indel | 24 | 25 | ||||
| splice donor/acceptor (+/-2bp) | 33 | 39 | ||||
| splice region | 2 | 54 | 59 | 3 | 118 | |
| non coding | 52 | 247 | 90 | 390 | ||
| Total | 181 | 71 | 984 | 627 | 93 |
Highest pathogenic variant AF is 0.00000657
Variants in BMPR1A
This is a list of pathogenic ClinVar variants found in the BMPR1A region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 10-86756209-G-A | Benign (Jun 14, 2019) | |||
| 10-86756311-G-T | Likely benign (Jun 15, 2019) | |||
| 10-86756333-G-C | Benign (Jun 14, 2019) | |||
| 10-86756413-T-G | Likely benign (Jul 23, 2018) | |||
| 10-86756585-C-T | Benign (Aug 19, 2019) | |||
| 10-86756637-CGGCGGCCGCTGCAGAGATTGGAATCCGCCTGCCGGGCTTGGCGAAGGAGAAGGGAGGAGGCAGGAGCGAGGAGGGAGGAGGGCCAAGGGCGGGCAGGAAGGCTTAGGCTCGGCGCGTCCGTCCGCGCGCGGCGAAGATCGCACGGCCCGATCGAGGGGCGACCGGGTCGGGGCCGCTGCACGCCAAGGGCGAAGGCCGATTCGGGCCCCACTTCGCCCCGGCGGCTCGCCGCGCCCACCCGCTCCGCGCCGAGGGCTGGAGGATGCGTTCCCTGGGGTCCG-C | Generalized juvenile polyposis/juvenile polyposis coli | Pathogenic (Dec 25, 2018) | ||
| 10-86756653-G-A | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 12, 2018) | ||
| 10-86756687-A-C | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 13, 2018) | ||
| 10-86756714-G-A | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 12, 2018) | ||
| 10-86756719-G-A | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 13, 2018) | ||
| 10-86756740-T-C | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 12, 2018) | ||
| 10-86756838-T-C | Generalized juvenile polyposis/juvenile polyposis coli | Benign (Apr 27, 2017) | ||
| 10-86756851-C-T | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 13, 2018) | ||
| 10-86756873-C-T | Generalized juvenile polyposis/juvenile polyposis coli | Uncertain significance (Jan 12, 2018) | ||
| 10-86756900-A-G | not specified • Generalized juvenile polyposis/juvenile polyposis coli | Conflicting classifications of pathogenicity (Apr 27, 2017) | ||
| 10-86756900-A-T | not specified | Likely benign (Nov 08, 2017) | ||
| 10-86756904-G-A | not specified | Likely benign (Apr 14, 2017) | ||
| 10-86756910-T-C | not specified | Likely benign (Sep 25, 2017) | ||
| 10-86756912-G-C | not specified | Likely benign (Feb 13, 2017) | ||
| 10-86756934-C-G | not specified | Likely benign (Aug 16, 2016) | ||
| 10-86756937-G-C | Benign (Sep 05, 2015) | |||
| 10-86756939-G-A | not specified | Likely benign (Mar 22, 2017) | ||
| 10-86757144-C-T | Likely benign (Jun 18, 2018) | |||
| 10-86757323-G-A | Benign (May 25, 2021) | |||
| 10-86758057-T-A | Likely benign (May 20, 2021) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| BMPR1A | protein_coding | protein_coding | ENST00000372037 | 11 | 176189 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.903 | 0.0967 | 125741 | 0 | 7 | 125748 | 0.0000278 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 1.92 | 206 | 299 | 0.688 | 0.0000176 | 3487 |
| Missense in Polyphen | 63 | 118.43 | 0.53195 | 1380 | ||
| Synonymous | 0.273 | 101 | 105 | 0.966 | 0.00000580 | 1002 |
| Loss of Function | 4.19 | 5 | 29.6 | 0.169 | 0.00000162 | 351 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.0000626 | 0.0000615 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.000109 | 0.000109 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000176 | 0.0000176 |
| Middle Eastern | 0.000109 | 0.000109 |
| South Asian | 0.0000327 | 0.0000327 |
| Other | 0.000164 | 0.000163 |
dbNSFP
Source:
- Function
- FUNCTION: On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for BMP2, BMP4, GDF5 and GDF6. Positively regulates chondrocyte differentiation through GDF5 interaction. Mediates induction of adipogenesis by GDF6. {ECO:0000250|UniProtKB:P36895}.;
- Disease
- DISEASE: Polyposis syndrome, mixed hereditary 2 (HMPS2) [MIM:610069]: A disease is characterized by atypical juvenile polyps, colonic adenomas, and colorectal carcinomas. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=A microdeletion of chromosome 10q23 involving BMPR1A and PTEN is a cause of chromosome 10q23 deletion syndrome, which shows overlapping features of the following three disorders: Bannayan-Zonana syndrome, Cowden disease and juvenile polyposis syndrome. {ECO:0000269|PubMed:11381269, ECO:0000269|PubMed:16525031}.;
- Pathway
- TGF-beta signaling pathway - Homo sapiens (human);Signaling pathways regulating pluripotency of stem cells - Homo sapiens (human);Hippo signaling pathway - Homo sapiens (human);Fluid shear stress and atherosclerosis - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);TGF-Core;Bone Morphogenic Protein (BMP) Signalling and Regulation;Heart Development;Integrated Breast Cancer Pathway;Hair Follicle Development- Induction (Part 1 of 3);Endoderm Differentiation;Mesodermal Commitment Pathway;Ectoderm Differentiation;Canonical and Non-Canonical TGF-B signaling;ESC Pluripotency Pathways;Endochondral Ossification;Signal Transduction;alk in cardiac myocytes;BMP2 signaling TAK1;TGF-beta super family signaling pathway canonical;IL-7 signaling;BMP receptor signaling;BMP Signalling Pathway;JAK STAT pathway and regulation;EPO signaling;BMP2 signaling TGF-beta MV;VEGF;Signaling by BMP;Signaling by TGF-beta family members;BMP signaling Dro
(Consensus)
Recessive Scores
- pRec
- 0.539
Intolerance Scores
- loftool
- 0.160
- rvis_EVS
- -0.4
- rvis_percentile_EVS
- 26.53
Haploinsufficiency Scores
- pHI
- 0.982
- hipred
- Y
- hipred_score
- 0.613
- ghis
- 0.603
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.999
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | High |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Bmpr1a
- Phenotype
- skeleton phenotype; immune system phenotype; vision/eye phenotype; hearing/vestibular/ear phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); limbs/digits/tail phenotype; pigmentation phenotype; neoplasm; hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; respiratory system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); embryo phenotype; homeostasis/metabolism phenotype; cellular phenotype; craniofacial phenotype; muscle phenotype; endocrine/exocrine gland phenotype; growth/size/body region phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan);
Zebrafish Information Network
- Gene name
- bmpr1ab
- Affected structure
- whole organism
- Phenotype tag
- abnormal
- Phenotype quality
- wholly dorsalized
Gene ontology
- Biological process
- in utero embryonic development;mesoderm formation;somitogenesis;Mullerian duct regression;positive regulation of mesenchymal cell proliferation;chondrocyte differentiation;outflow tract septum morphogenesis;outflow tract morphogenesis;cardiac conduction system development;mitral valve morphogenesis;tricuspid valve morphogenesis;endocardial cushion morphogenesis;cardiac right ventricle morphogenesis;ventricular trabecula myocardium morphogenesis;ventricular compact myocardium morphogenesis;endocardial cushion formation;protein phosphorylation;immune response;transforming growth factor beta receptor signaling pathway;pattern specification process;ectoderm development;dorsal/ventral axis specification;regulation of cardiac muscle cell apoptotic process;positive regulation of pathway-restricted SMAD protein phosphorylation;neural crest cell development;negative regulation of smooth muscle cell migration;stem cell population maintenance;pituitary gland development;neural plate mediolateral regionalization;lung development;positive regulation of bone mineralization;BMP signaling pathway;hindlimb morphogenesis;dorsal aorta morphogenesis;odontogenesis of dentin-containing tooth;embryonic digit morphogenesis;positive regulation of osteoblast differentiation;positive regulation of transcription by RNA polymerase II;paraxial mesoderm structural organization;lateral mesoderm development;regulation of lateral mesodermal cell fate specification;mesendoderm development;embryonic organ development;developmental growth;positive regulation of epithelial cell proliferation;negative regulation of neurogenesis;roof of mouth development;regulation of cardiac muscle cell proliferation;positive regulation of cardiac muscle cell proliferation;positive regulation of SMAD protein signal transduction;heart formation;BMP signaling pathway involved in heart development;pharyngeal arch artery morphogenesis;cellular response to BMP stimulus;positive regulation of pri-miRNA transcription by RNA polymerase II;positive regulation of cardiac ventricle development;positive regulation of vascular smooth muscle cell proliferation;fibrous ring of heart morphogenesis;regulation of neural crest cell differentiation;regulation of cellular senescence
- Cellular component
- plasma membrane;integral component of plasma membrane;caveola;external side of plasma membrane;integral component of membrane;dendrite;neuronal cell body;receptor complex;HFE-transferrin receptor complex
- Molecular function
- DNA-binding transcription factor activity, RNA polymerase II-specific;protein serine/threonine kinase activity;transmembrane receptor protein serine/threonine kinase activity;transforming growth factor beta-activated receptor activity;transforming growth factor beta receptor activity, type I;protein binding;ATP binding;growth factor binding;protein homodimerization activity;SMAD binding;metal ion binding;BMP receptor activity