C12orf4

chromosome 12 open reading frame 4

Basic information

Region (hg38): 12:4487734-4538508

Links

ENSG00000047621 ∙ NCBI:57102 ∙ OMIM:616082 ∙ HGNC:1184 ∙ Uniprot:Q9NQ89 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• intellectual disability, autosomal recessive 66 (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Intellectual developmental disorder, autosomal recessive 66	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Musculoskeletal; Neurologic	25558065; 27311568; 28097321

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the C12orf4 gene.

• not provided (3 variants)
• Intellectual disability, autosomal recessive 66 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the C12orf4 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				5		5
missense		1	4	1		6
nonsense	3	3				6
start loss						0
frameshift	1	3	1			5
inframe indel						0
splice donor/acceptor (+/-2bp)			1			1
splice region				1		1
non coding					2	2
Total	4	7	6	6	2

Variants in C12orf4

This is a list of pathogenic ClinVar variants found in the C12orf4 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
12-4490514-T-C			Likely benign (Jan 26, 2018)
12-4490521-C-G			Uncertain significance (Jun 29, 2022)
12-4490600-A-C		not specified	Benign/Likely benign (Jan 06, 2020)
12-4491202-C-T			Likely benign (Jun 01, 2023)
12-4500218-G-A		Intellectual disability, autosomal recessive 66	Pathogenic/Likely pathogenic (Apr 15, 2024)
12-4505342-T-TAC		Intellectual disability, autosomal recessive 66	Likely pathogenic (Oct 22, 2019)
12-4505374-CC-G		Intellectual disability, autosomal recessive 66	Likely pathogenic (Apr 06, 2022)
12-4517091-G-A			Pathogenic (Oct 23, 2020)
12-4517141-A-G			Benign/Likely benign (Oct 01, 2023)
12-4517145-G-A		Intellectual disability, autosomal recessive 66	Likely pathogenic (May 28, 2020)
12-4517178-CTG-C		Intellectual disability, autosomal recessive 66	Pathogenic (Dec 21, 2023)
12-4517618-AAAAGTGAATTGTACTAAGAGGGAAGGTAGAATTTTACCTAGCAAATTTAAGAGGTAGGTTATTAAAATATATATATATATATATATATAGACAGAGAGAGAGAGAGAGAGAGAGAGAGAGACAAATGGATGAGCTAAAAATCACCAAGCCAGAATTTGCTTCTAAACTGAAAACATGTGATTGCTCTTTTTGTTTTACCTCGTAATGAGAATTCTATAAAAACATTATTTATAATAGCATTTTAAGAAAAATAAATATGAAGCACTCTATCGATGCTACAGTTTGAAATAAAATAACTATGGCTGGGTATGTTTGTTTGGTCTACTTGGATGTCAAGGTGATTAAAATTTTTTTTCATTTTCCCTGTAATTCCTTTCTTTGTAAGAATGGTGTTACAGGATGAAATTTAACAAAATAAATGTGTATGATGTTAACTTACCTCTTTTAATACCACTATATGAATTAATTCGATTATCTACTAGTAAAACCAGGCCACAGAGAGATGTAGAATAAAGTGACAGAGCTGTTTGGAGCCGATGAAGTTTCACACCACTTCGATGATTTCTTTTATGCTTACAGAAGTCCAGCATATCTGCTCTCAGCAATCTCAAATTATGCATGGTCTTCAACTGGGCTCCTGGGGGTAGGCAATAGTCCAGGAAAGATACTTAAGCAGCTACAGAAAGTCCAGTATAACAAGATGCAAATCTCTATGGCAAGAATCCAGATAAATCTGTACCACAAAATAATTAAAAATGGGCCTTGCAACTTCCCATTTTAATGACTTTTTCAGTTTAATCTATCTGCAAAAAACATTATATAAATATACAAAACTTAAAGCCAATAAAATATAGTCTTTCTTAAAGTAAAACATAATTTGGAATTAAAAATAACATAGGTACACTCTACTCACATGTTAGGAATTTTTCTCTTACAGCATATAAAAAAAGTTGCAGCGGTCAGGCACGGTGACTCATGCCTGTAATCCTAGCACTTTGGGAGGCCAAGGTGGGTGGATTGCTTGAGCCCAGGGGTTCAAGACCAGCCTGGGCAACATAGCGAAACCTTTTCTCTATTATTTTAAAAAAATAATAATTAAAAAATAGTTTCAGAAGTTACAATAAATTATAACTGCAAAAAAATTAACACACTTACCTAAGTGAATGGTAAAACTTTCTTCTAACTTTCTCTG-TCATAA		Intellectual disability, autosomal recessive 66	Likely pathogenic (May 28, 2020)
12-4517710-CAG-C			Benign (Dec 09, 2020)
12-4518108-A-G		Intellectual disability, autosomal recessive 66	Likely pathogenic (Feb 14, 2020)
12-4518175-G-A			Likely pathogenic (Jan 30, 2024)
12-4518790-ACTTT-A			Pathogenic (Jun 27, 2022)
12-4518843-A-G		Intellectual disability, autosomal recessive 66	Uncertain significance (May 17, 2021)
12-4518881-C-T			Likely pathogenic (Nov 16, 2023)
12-4525312-G-A		C12orf4-related disorder	Likely pathogenic (Sep 16, 2023)
12-4525339-A-ATTGT			Uncertain significance (Apr 09, 2016)
12-4525342-G-GTTGT		Intellectual disability;Attention deficit hyperactivity disorder;Hypotonia • Intellectual disability, autosomal recessive 66	Pathogenic/Likely pathogenic (Jan 13, 2015)
12-4525355-C-T			Likely benign (Feb 01, 2021)
12-4525493-T-C			Likely benign (Mar 01, 2024)
12-4525561-CTT-C		Intellectual disability, autosomal recessive 66	Likely pathogenic (May 20, 2023)
12-4525579-C-G		Inborn genetic diseases	Uncertain significance (Jul 06, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
C12orf4	protein_coding	protein_coding	ENST00000261250	13	50781

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0000107	0.999	125685	0	62	125747	0.000247

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.53	209	281	0.744	0.0000137	3632
Missense in Polyphen		53	102.8	0.51555		1296
Synonymous	2.75	64	98.7	0.648	0.00000475	991
Loss of Function	3.03	14	32.7	0.429	0.00000178	401

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000744	0.000726
Ashkenazi Jewish	0.000308	0.000298
East Asian	0.000169	0.000163
Finnish	0.00	0.00
European (Non-Finnish)	0.000261	0.000255
Middle Eastern	0.000169	0.000163
South Asian	0.000282	0.000261
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Plays a role in mast cell degranulation. {ECO:0000250|UniProtKB:D4A770}.

Intolerance Scores

• loftool: 0.388
• rvis_EVS: -0.6
• rvis_percentile_EVS: 17.75

Haploinsufficiency Scores

• hipred: N
• hipred_score: 0.488
• ghis: 0.657

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: D6Wsu163e

Gene ontology

• Biological process: regulation of mast cell degranulation
• Cellular component: cytoplasm