C14orf39

chromosome 14 open reading frame 39

Basic information

Region (hg38): 14:60396468-60515543

Links

ENSG00000179008 ∙ NCBI:317761 ∙ OMIM:617307 ∙ HGNC:19849 ∙ Uniprot:Q8N1H7 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• spermatogenic failure 52 (Limited), mode of inheritance: Unknown
• premature ovarian failure 18 (Limited), mode of inheritance: Unknown

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Spermatogenic failure 52; Premature ovarian failure 18	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Genitourinary; Obstetric	33508233

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the C14orf39 gene.

• not provided (5 variants)
• Inborn genetic diseases (3 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the C14orf39 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				2		2
missense			3	2	1	6
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding						0
Total	0	0	3	4	1

Variants in C14orf39

This is a list of pathogenic ClinVar variants found in the C14orf39 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
14-60436905-A-C			Likely benign (Feb 01, 2023)
14-60455118-T-G			Likely benign (Sep 01, 2023)
14-60456996-A-G		C14orf39-related disorder	Likely benign (Feb 11, 2022)
14-60457040-TCTA-T		Inherited primary ovarian failure	Uncertain significance (Mar 03, 2022)
14-60457098-G-C		Spermatogenic failure 52 • Non-obstructive azoospermia	Pathogenic (Feb 23, 2021)
14-60461410-A-G		not specified	Uncertain significance (Oct 06, 2021)
14-60461548-T-C		not specified	Likely benign (Jul 14, 2021)
14-60465993-C-A		Spermatogenic failure 52 • Non-obstructive azoospermia	Pathogenic (Feb 23, 2021)
14-60466013-T-C		not specified	Uncertain significance (Oct 26, 2021)
14-60469606-T-C			Uncertain significance (Feb 02, 2022)
14-60471597-T-G		not specified	Uncertain significance (Nov 10, 2021)
14-60471601-T-C			Likely benign (Aug 01, 2023)
14-60483718-CTA-C		Spermatogenic failure 52 • Premature ovarian failure 18 • Non-obstructive azoospermia • Azoospermia	Pathogenic (Dec 20, 2021)
14-60483791-T-C			Benign (Oct 01, 2023)
14-60509167-GCCGGCGTGCCTGAGCCGAGCCGAGCCCGAACCCCAAGCCGCGGAGCCAGCACCTCCTCCAGTCGGGGTCGTCCGCTCCCGGCCGTTGAGCCACCGCCGCCACCCGGTAGTGTGTCCCGCTGCCCCAATCCGCCTCATCAACAAGCGCCTGGCACACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCGGGCTCAGTGCCCTCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATTTCAGCCCCCAGCAAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGCGCCTGGGTCGCTTCCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACAAGAATGAGTCGGTGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCGAGCTCTATCATATCCTGGAAAACCACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGGCGCTGTGGCTTGAAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGACCTGTGGACAAGTACCGAGTAAGGAAGAAGTTCCCGCTGCCGCGCACCATTTGGGACGGCGAACAGAAGACACACTGCTTCAAGGAGCGCACGCGGCACCTGCTACGCGAGTGGTACCTGCAGGATCCATACCCTAACCCCAGCAAAAAACGTGAGCTCGCCCAGGCAACCGGACTGACCCCTACGCAGGTGGGCAACTGGTTCAAAAACCGCCGACAAAGGGACCGAGCGGCTGCAGCCAAGAACAGGTCGGTACCTAGAGGCCTCCGCGCTTTGAGCGCACCGGGGAGGAGGCGGGTGGAGGCACCTCTGGCGCCCTTACCCAGTCCCTGGCGACTCCAATTCAGCAGGAGTTGGGAGCGCGGTCTGTCTTGGGTTAAGAGCCCTGCGTTCTGGGCTCCTGGCCGGGAGTTCCCTTGCCGGCTCTGCTTCCCCACCCGCTGGCTCCCCACGCCTGCGGGCAGCTGCAGCAGCTGGTC-G		Sclerocornea;Developmental cataract;Cornea plana;Microphthalmia	Pathogenic (-)
14-60509225-C-G		Anophthalmia-microphthalmia syndrome	Uncertain significance (Jan 13, 2018)
14-60509238-T-C		Anophthalmia-microphthalmia syndrome	Benign (Jun 26, 2018)
14-60509250-C-T		Anophthalmia-microphthalmia syndrome	Likely benign (Jan 13, 2018)
14-60509252-T-C		Anophthalmia-microphthalmia syndrome	Likely benign (Apr 24, 2019)
14-60509285-G-A		Anophthalmia-microphthalmia syndrome	Uncertain significance (Jan 12, 2018)
14-60509335-C-T		Anophthalmia-microphthalmia syndrome	Likely benign (Mar 24, 2019)
14-60509408-C-A			Uncertain significance (Sep 10, 2021)
14-60509410-G-C			Likely benign (Nov 15, 2022)
14-60509416-C-A		Anophthalmia-microphthalmia syndrome	Conflicting classifications of pathogenicity (Jun 01, 2022)
14-60509416-C-T			Benign (Jan 24, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
C14orf39	protein_coding	protein_coding	ENST00000321731	17	119075

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00000273	0.999	125685	0	11	125696	0.0000438

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.218	273	263	1.04	0.0000122	3879
Missense in Polyphen		48	47.089	1.0193		661
Synonymous	-1.18	102	88.0	1.16	0.00000440	967
Loss of Function	2.95	15	33.4	0.449	0.00000155	493

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000127	0.000123
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.0000548	0.0000528
Middle Eastern	0.00	0.00
South Asian	0.0000654	0.0000654
Other	0.000204	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Meiotic protein that localizes to the central element of the synaptonemal complex and is required for chromosome synapsis during meiotic recombination. Required for the appropriate processing of intermediate recombination nodules before crossover formation. {ECO:0000250|UniProtKB:Q9CTN5}.

Intolerance Scores

• rvis_EVS: 1.18
• rvis_percentile_EVS: 92.78

Haploinsufficiency Scores

• pHI: 0.113
• hipred: N
• hipred_score: 0.324

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	High
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: 4930447C04Rik
• Phenotype: reproductive system phenotype; cellular phenotype; endocrine/exocrine gland phenotype