CCND2-AS1

CCND2 antisense RNA 1, the group of Antisense RNAs

Basic information

Region (hg38): 12:4247981-4276265

Previous symbols: [ "CCND2-AS2" ]

Links

ENSG00000255920 ∙ NCBI:103752584 ∙ ∙ HGNC:49398 ∙ ∙ ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CCND2-AS1 gene.

• not provided (14 variants)
• Inborn genetic diseases (2 variants)
• not specified (1 variants)
• Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CCND2-AS1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense						0
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding			4	10	4	18
Total	0	0	4	10	4

Variants in CCND2-AS1

This is a list of pathogenic ClinVar variants found in the CCND2-AS1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
12-4273433-A-G			Benign (Jun 16, 2018)
12-4273870-C-T			Benign (Jun 14, 2018)
12-4273992-T-C		Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3	Benign (Jul 14, 2021)
12-4274005-G-T		not specified	Benign (Jun 05, 2017)
12-4274049-G-A			Likely benign (Dec 05, 2022)
12-4274065-G-T			Uncertain significance (Oct 03, 2023)
12-4274073-C-T		CCND2-related disorder	Likely benign (Jan 11, 2024)
12-4274128-C-A		Inborn genetic diseases	Uncertain significance (Nov 08, 2022)
12-4274134-A-G			Uncertain significance (Aug 04, 2023)
12-4274140-G-C			Uncertain significance (Jun 24, 2022)
12-4274153-T-G		Inborn genetic diseases	Uncertain significance (Jan 09, 2024)
12-4274154-T-G		CCND2-related disorder	Benign/Likely benign (Nov 01, 2023)
12-4274162-G-A			Uncertain significance (Jul 01, 2024)
12-4274242-C-CG			Benign (Jan 19, 2024)
12-4274252-C-A			Likely benign (Nov 03, 2022)
12-4274504-A-C			Likely benign (Jun 26, 2018)
12-4275795-ATACCAAAGCACTGATGGGCTATTCTGATTCACTCCAGTTTCCTCATCTTTGTTCTTTATTCTTATCACGCATTCTGGTCCCCTCCCCCTCCCACAAAAAAAAATTAATTTTTTTTGTTTCGATAGATTACGCTTTTTTATTCTTTTTCTCTTTTGCTGATGCTATGCTCTCCACCCCCGCCCCCCAACCCTTTCCCACTCCCATTATAGGTCTGTGAGGAACAGAAGTGCGAAGAAGAGGTCTTCCCTCTGGCCATGAAT-A		Inborn genetic diseases	Uncertain significance (May 31, 2024)
12-4275901-A-T			Likely benign (Jul 06, 2018)
12-4275974-G-C			Likely benign (Aug 18, 2019)
12-4275986-T-C			Likely benign (Sep 19, 2023)
12-4275998-A-C			Likely benign (Dec 31, 2019)
12-4276004-G-A		Megalencephaly-polymicrogyria-polydactyly-hydrocephalus syndrome 3	Uncertain significance (Sep 01, 2022)
12-4276031-A-G			Likely benign (Jan 15, 2024)
12-4276040-C-T			Likely benign (Dec 02, 2021)
12-4276043-T-A			Likely benign (Apr 04, 2021)

GnomAD

Source: gnomAD

dbNSFP

Source: dbNSFP