CDCA7L

cell division cycle associated 7 like

Basic information

Region (hg38): 7:21900899-21945903

Links

ENSG00000164649 ∙ NCBI:55536 ∙ OMIM:609685 ∙ HGNC:30777 ∙ Uniprot:Q96GN5 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CDCA7L gene.

• Primary ciliary dyskinesia (23 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CDCA7L gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense			22	3		25
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding	23	7	47	54	4	135
Total	23	7	69	57	4

Highest pathogenic variant AF is 0.0000263

Variants in CDCA7L

This is a list of pathogenic ClinVar variants found in the CDCA7L region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
7-21900939-AACTT-A			Benign (Feb 04, 2020)
7-21900987-C-A		Primary ciliary dyskinesia	Likely benign (Jul 28, 2023)
7-21900987-C-T		Primary ciliary dyskinesia	Likely benign (Oct 13, 2023)
7-21900987-CCG-C		Primary ciliary dyskinesia	Likely benign (Apr 20, 2023)
7-21900988-C-A		Primary ciliary dyskinesia	Likely benign (Aug 29, 2023)
7-21900988-C-G		Primary ciliary dyskinesia	Likely benign (Sep 29, 2023)
7-21900988-C-T		Primary ciliary dyskinesia • Primary ciliary dyskinesia 7	Likely benign (Jan 28, 2024)
7-21900989-G-A		Primary ciliary dyskinesia • Primary ciliary dyskinesia 7	Likely benign (Jan 31, 2024)
7-21900990-CTG-C		Primary ciliary dyskinesia	Likely benign (Dec 26, 2023)
7-21900992-G-A		Primary ciliary dyskinesia	Likely benign (Nov 21, 2023)
7-21900994-G-C		Primary ciliary dyskinesia	Likely benign (Nov 17, 2023)
7-21900994-G-GT		Primary ciliary dyskinesia	Benign (Dec 13, 2023)
7-21901000-G-T		Primary ciliary dyskinesia	Likely benign (Dec 17, 2023)
7-21901001-C-T		Primary ciliary dyskinesia	Likely benign (Nov 25, 2023)
7-21901002-C-T		Primary ciliary dyskinesia	Likely benign (Oct 12, 2023)
7-21901008-C-T		not specified • Primary ciliary dyskinesia	Conflicting classifications of pathogenicity (Jan 29, 2024)
7-21901009-G-A		Primary ciliary dyskinesia	Pathogenic (Nov 05, 2023)
7-21901011-C-A		Primary ciliary dyskinesia	Likely benign (Jan 06, 2024)
7-21901012-C-T		Primary ciliary dyskinesia	Uncertain significance (Aug 21, 2022)
7-21901013-G-A		Primary ciliary dyskinesia • Primary ciliary dyskinesia 7	Uncertain significance (Oct 21, 2021)
7-21901016-G-A		Primary ciliary dyskinesia	Pathogenic (Jul 06, 2023)
7-21901019-A-G		Primary ciliary dyskinesia	Uncertain significance (Jun 20, 2023)
7-21901022-C-T		Primary ciliary dyskinesia	Uncertain significance (Dec 19, 2021)
7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCTCAAGGAGCTGGCATGCCCTATGCCGGTCATCTTTGCAAAAGCCACCCCCGTGGACAGACAAGAAAC		Primary ciliary dyskinesia	Pathogenic (Sep 10, 2021)
7-21901021-A-ACCCAAGCAGGAACCATTGTTGAAGCCCGTCT		Primary ciliary dyskinesia	Pathogenic (Sep 21, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CDCA7L	protein_coding	protein_coding	ENST00000406877	10	45185

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000179	0.999	125696	0	52	125748	0.000207

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.0884	275	271	1.02	0.0000167	2982
Missense in Polyphen		56	84.17	0.66532		858
Synonymous	-2.30	124	95.5	1.30	0.00000551	832
Loss of Function	2.85	11	27.0	0.408	0.00000179	283

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000623	0.000621
Ashkenazi Jewish	0.00	0.00
East Asian	0.000109	0.000109
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.000197	0.000176
Middle Eastern	0.000109	0.000109
South Asian	0.000229	0.000229
Other	0.000328	0.000326

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Plays a role in transcriptional regulation as a repressor that inhibits monoamine oxidase A (MAOA) activity and gene expression by binding to the promoter. Plays an important oncogenic role in mediating the full transforming effect of MYC in medulloblastoma cells. Involved in apoptotic signaling pathways; May act downstream of P38-kinase and BCL-2, but upstream of CASP3/caspase-3 as well as CCND1/cyclin D1 and E2F1. {ECO:0000269|PubMed:15654081, ECO:0000269|PubMed:15994933, ECO:0000269|PubMed:16829576}.
• Pathway: Sudden Infant Death Syndrome (SIDS) Susceptibility Pathways (Consensus)

Recessive Scores

• pRec: 0.119

Intolerance Scores

• loftool: 0.894
• rvis_EVS: -1.07
• rvis_percentile_EVS: 7.43

Haploinsufficiency Scores

• pHI: 0.349
• hipred: Y
• hipred_score: 0.659
• ghis: 0.598

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.990

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Cdca7l

Gene ontology

• Biological process: regulation of transcription, DNA-templated;positive regulation of cell population proliferation
• Cellular component: fibrillar center;nucleus;nucleolus;cytosol
• Molecular function: protein binding