CDK10

cyclin dependent kinase 10, the group of Spliceosomal P complex|Cyclin dependent kinases|Spliceosomal C complex

Basic information

Region (hg38): 16:89680736-89696354

Links

ENSG00000185324 ∙ NCBI:8558 ∙ OMIM:603464 ∙ HGNC:1770 ∙ Uniprot:Q15131 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• Al Kaissi syndrome (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Al Kaissi syndrome	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Musculoskeletal; Neurologic	28886341

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CDK10 gene.

• Al Kaissi syndrome (31 variants)
• Inborn genetic diseases (30 variants)
• not provided (23 variants)
• Abnormal brain morphology (2 variants)
• Global developmental delay (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CDK10 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				5		5
missense	2	1	32	4		39
nonsense	2	2				4
start loss						0
frameshift	5	4				9
inframe indel	1					1
splice donor/acceptor (+/-2bp)	2	1				3
splice region	2					2
non coding			3	2	2	7
Total	12	8	35	11	2

Highest pathogenic variant AF is 0.0000197

Variants in CDK10

This is a list of pathogenic ClinVar variants found in the CDK10 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
16-89686720-C-G			Likely benign (Mar 01, 2024)
16-89686722-A-T			Likely benign (Mar 01, 2024)
16-89686734-C-A		Al Kaissi syndrome	Pathogenic/Likely pathogenic (-)
16-89686735-G-C		Al Kaissi syndrome • Inborn genetic diseases	Uncertain significance (Jan 17, 2024)
16-89686747-C-A		Inborn genetic diseases	Uncertain significance (May 30, 2022)
16-89686751-A-G		Inborn genetic diseases	Uncertain significance (Aug 16, 2021)
16-89686761-T-G		Al Kaissi syndrome	Conflicting classifications of pathogenicity (Jun 01, 2022)
16-89686796-G-A		Inborn genetic diseases	Uncertain significance (May 10, 2021)
16-89686802-G-A		Al Kaissi syndrome	Pathogenic (-)
16-89688381-TTACATGTGCTTCTTAGATCCATGGAGAAGGATACAGACTCTACTAGTTCAGAGACCCCAAAATACAGGGCCTCAAGATGATGCCTTTTTTCACTCTCCCCTAACATTCTGGAGAGAAGCAGTTGTTTTGCACAGGTGGGTCAGGCATTCTGGTTCCATTTTTTCTTCCCGTCACTGAGGTGAGAAGAGGTGAAAGCTTCCTTTCACCTGGAAGTCACACGGTCCCTTCAGCTCACATTCCAAGGCCAGATGCCACTGGGTAGCGTTTCATAACTTCCAGGAGGTAGTGATACAGGGATGCTGGGACAGCAGCCTCTGCCACAGATGTATTTTTGTATGTGGGATTGAAAGGGAGTATCTGAGTGGCCGCCTCTGATATTTCTTTCAAAGCATTGGCCCAGTATCGTCACCACCTTTTCTCATCAGAAAAGCCCAAGAGGCCGGGTACGGTGGCTCACGCTTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGGCAGATCACTTGAGGTCAGGAGCTCAAGACCAGCCTGGCCAACATGGTGAAACCCAGTCTCTACTAAAAATAGAAAATTAGGCGGTTGTGGTGGCACCTGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCCGGAGAATCACTTGAACCCAGGAGGCGGAGGTTGCAGTGAACCATGTTCTTGCCACTGCACTCCAGCCTGGGCAACAGAGCGAGACTCAGTCTCAAAAAAAGAAAAAAAAAGCCCAAACGTGTGGTTGCCTTTCTGTTTGGTGAGCAAGACGTGAGTGGGCTCCCTGGTACAAATTCCATTTGAAATTTCCTCAGTTGTTCCATCAGCTGCCAAATTTCCACACTGGCAACACCCTTCTGTTTCAGCTGGGACGATGCCGGAGTGTGAAGGAGTTTGAGAAGCTGAACCGCATTGGAGAGGGTACCTACGGCATTGTGTGTGAGTGGCCAAGGCTAGGACATGTGGCCGCAGCTCGTGGCTGTGACAGTGTGGGACGAGACTGTCGAAGCAGCAGCCGCGTTGGGGCTGGAAGGGACTCAGACCCTGTGCTCTGAAACAGGGCAGAAACCTGTTCAGGAACTTCAATTCCTGATGTAGTTATCACAAACATTGTACCATTTCTGGGTAAACGTAAGCATCCGGTTGCTAATGCCCATAATCCAAACGTGTCACTGCAGAGTACACAGAACTGTTAGAGAAATAAAATACAGAACTTTCCAGAAGCAGCAGGAGCTGGACATGGTGCTCATGTCTATCACCTCAGCAACTCTGGAGGAGTCACCTGAGCCCAGGTGTTTTTTCTTTTTGTTTGTTTTTGAGATGGGTCTTGCTCTATTGCCCAGACTGGAGTGCAGTGGCATGATCATAGCTCACTGCGGCCTCGACCTCCTAGGCTCAAGTGATCCTCCCACCTCAGCCTCCTGAGTATCTGGGACCACAAGAGTACATAAGCACACCCAGCTAATTTTTAAATTTTTGGTAGAGATGGGATCTCCCTATGTTGCCCAGGCTGGTCTTGAACTTCTGGGCTCAAATGATCCTCCTGCCTCGGCCTCCCAAAGCACTGGGATTACAGGTGTGAGCCACTGCACCCGGCCAAGCCTAGGAGTTTGAGGCTGCAGTGAGCTGTGATCACGCCACTGCACCCCAGCCTTGGCAACAGAGTGAGACCCTGTCTCAAAAAAACCAAAAACACCACACACAACTAAAGGTTATAACAGATGTGAAATTGGCGTAGGTCATTCTGGAAGCTGCACACATTAGCAGGATGTTTTGTAGAGCCATCTTCACACAAAATAAGGTTTGCTTTTTTCTGCATAGAGTACCTTATTTGCTTTTAGGACATTACAAGAGAGCACAAAGCAGTGATCTGCATGCTAAGGAGGACATGGAGAGCCTGGAGCCACAGAACTGAGTGGCTGGAGGCCAGGGTCCAGCACAGAGCAAAGTTGGGCACCCCCTGCCCAGTTCAAATGAGGAAACCCTCCGGGGGAACGCGTCTCGGGCTAGGGGCGTTGCACAGAGTGGGGACTGAGTGTCACTGGGCATGAGGTTGTCAGAGGAAAGAACGGGGACCCCTGTGGCTCAGGGAGAGCCTCCCGTTCAGCGCTAGGGAGCCCACGAGGGGCATCGAGATGATGTCATCACCAATGTGTTTCCATTCCAGATCGGGCCCGGGACACCCAGACAGATGAGATTGTCGCACTGAAGAAGGTGCGGATGGACAAGGAGAAGGATGGTGAGCAGGAAATTGGGGTGTTGGGACCTCGCACTGGGAGGAGGCAGAAGGATGTGAGTTACCTGAAGTTTCCTCAGAGCGACTGCACGGTGCTTGTAGCGGGGGCCGGCCTCTGGGAGGGTTCTGGTGTGGCCCAGCACATCACCCCCAGGTCCACACGCAGCCTCAGCTGTCTGCCAGGAGGGCTCTGCAGTCTCCATCCCCTCCTCCCCCTCCTGTCTGGTGAGGCCACCTCACTGCAGGCTCAGCTCTGCTGTCCCCTCCACCCCCAGCACCTGCCTGTGCAGGCAGGGCCCTGCCATGCCCCACATAGATGTCCACGGTGTTTAGAGAGGTGCCGATTCGTATTTGGTCAAGGAAGAGTTAAA-T		Al Kaissi syndrome	Pathogenic (Oct 02, 2017)
16-89689262-G-A		Inborn genetic diseases	Uncertain significance (Jan 10, 2022)
16-89689265-G-A		Inborn genetic diseases	Uncertain significance (Sep 15, 2021)
16-89689302-AG-A		Al Kaissi syndrome	Likely pathogenic (Mar 29, 2024)
16-89690552-G-C		Al Kaissi syndrome	Pathogenic (-)
16-89690561-C-T		Al Kaissi syndrome • Inborn genetic diseases	Uncertain significance (Jun 27, 2022)
16-89690562-G-A		Inborn genetic diseases	Uncertain significance (Apr 07, 2022)
16-89690567-AC-A		Inborn genetic diseases	Pathogenic (Nov 08, 2017)
16-89690594-A-T			Likely pathogenic (Jul 10, 2021)
16-89690600-G-A		Inborn genetic diseases	Uncertain significance (Sep 27, 2021)
16-89690618-A-T		Al Kaissi syndrome	Pathogenic (-)
16-89691473-C-G		Al Kaissi syndrome	Uncertain significance (Jul 24, 2019)
16-89691505-G-A		Inborn genetic diseases	Uncertain significance (Aug 08, 2023)
16-89691505-G-C		Al Kaissi syndrome	Uncertain significance (Aug 23, 2018)
16-89691507-G-GGA		Al Kaissi syndrome	Likely pathogenic (Feb 01, 2022)
16-89691523-G-A		Inborn genetic diseases	Uncertain significance (Feb 01, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CDK10	protein_coding	protein_coding	ENST00000353379	13	15628

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
1.19e-16	0.00556	125648	0	99	125747	0.000394

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.461	252	232	1.09	0.0000151	2302
Missense in Polyphen		67	81.483	0.82226		797
Synonymous	-2.61	130	97.3	1.34	0.00000636	712
Loss of Function	-0.149	24	23.2	1.03	0.00000127	249

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000490	0.000478
Ashkenazi Jewish	0.00359	0.00358
East Asian	0.000273	0.000272
Finnish	0.00	0.00
European (Non-Finnish)	0.000333	0.000325
Middle Eastern	0.000273	0.000272
South Asian	0.000296	0.000294
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Cyclin-dependent kinase that phosphorylates the transcription factor ETS2 (in vitro) and positively controls its proteasomal degradation (in cells) (PubMed:24218572). Involved in the regulation of actin cytoskeleton organization through the phosphorylation of actin dynamics regulators such as PKN2. Is a negative regulator of ciliogenesis through phosphorylation of PKN2 and promotion of RhoA signaling (PubMed:27104747). {ECO:0000269|PubMed:24218572, ECO:0000269|PubMed:27104747}.
• Disease: DISEASE: Al Kaissi syndrome (ALKAS) [MIM:617694]: An autosomal recessive developmental disorder characterized by growth retardation, spine malformation, facial dysmorphisms, and developmental delay. {ECO:0000269|PubMed:28886341}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Intolerance Scores

• loftool: 0.863
• rvis_EVS: 0.07
• rvis_percentile_EVS: 58.96

Haploinsufficiency Scores

• pHI: 0.178
• hipred: Y
• hipred_score: 0.508
• ghis: 0.597

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.987

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Cdk10
• Phenotype: limbs/digits/tail phenotype; immune system phenotype; skeleton phenotype; renal/urinary system phenotype; respiratory system phenotype; liver/biliary system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); hematopoietic system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); muscle phenotype; craniofacial phenotype; growth/size/body region phenotype

Zebrafish Information Network

• Gene name: cdk10
• Affected structure: retinal ganglion cell
• Phenotype tag: abnormal
• Phenotype quality: decreased amount

Gene ontology

• Biological process: protein phosphorylation;traversing start control point of mitotic cell cycle;negative regulation of cell population proliferation;peptidyl-threonine phosphorylation;cell projection organization;regulation of actin cytoskeleton organization;positive regulation of MAPK cascade;negative regulation of cilium assembly
• Cellular component: nucleus;cytoplasm;ciliary basal body
• Molecular function: protein serine/threonine kinase activity;cyclin-dependent protein serine/threonine kinase activity;protein binding;ATP binding