CEP152

centrosomal protein 152

Basic information

Region (hg38): 15:48712928-48811146

Links

ENSG00000103995 ∙ NCBI:22995 ∙ OMIM:613529 ∙ HGNC:29298 ∙ Uniprot:O94986 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• microcephaly 4, primary, autosomal recessive (Definitive), mode of inheritance: AR
• autosomal recessive primary microcephaly (Supportive), mode of inheritance: AR
• Seckel syndrome (Supportive), mode of inheritance: AR
• microcephaly 9, primary, autosomal recessive (Strong), mode of inheritance: AR
• microcephaly with or without short stature (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Seckel syndrome 5; Microcephaly 9, primary, autosomal recessive	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Musculoskeletal; Neurologic	20598275; 21131973

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CEP152 gene.

• not provided (79 variants)
• Microcephaly 9, primary, autosomal recessive (5 variants)
• Microcephaly 9, primary, autosomal recessive;Seckel syndrome 5 (1 variants)
• CEP152-related disorder (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CEP152 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			4	315	2	321
missense		2	226	14	4	246
nonsense	37	5	3	3		48
start loss						0
frameshift	44	7	2	7		60
inframe indel			4			4
splice donor/acceptor (+/-2bp)	2	22	2			26
splice region			8	51	3	62
non coding			15	164	48	227
Total	83	36	256	503	54

Highest pathogenic variant AF is 0.0000460

Variants in CEP152

This is a list of pathogenic ClinVar variants found in the CEP152 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
15-48717160-G-T			Likely benign (Jun 01, 2023)
15-48737953-AGTTTATTTAAATAAGTTAACACTGCAGAGTGAGTCAATTTATAAGTATAAAAATAGATGGTTTAGAAACCAAAAATAAGCACCACACAAAAGCAGATTATACATACACCATCAGGCCTTTGGAATATTAAGGCAACATAAATATCTCAAGCAATTTTAGAAGAATGCTTTACTTATATAACAGATGTTATTAAAACATCTCAAAAGAGGCAGGGCTCACAATTTTTTTCAGTATGAGGTCTTCCCTTCCATTTTTGTTAATATATTAATGATTCTTCTTAAATACTGTACCATAATTAGTCTAGATTAACAAATGGGCTATCAAAGCCACTATCTTGTTGGCTAGATAGCGGAACAATTAATTTTCTTGAAGGCTGCTGACACACTGAAGATGGTAATGTACTGCTCAGTTTTTTGAAATCTGACTTTAATCTATCAGCCTTATGACGAGATGGGTGTCCACAATTCACACTGATCTTTCCTGGCTCCAAATACGTGGTTTCTTCTGACAGGTATGGAGTTTGATAACGCTGACATTTCATTGTTTGACAAATCATATTACTTTCCTCTGTATCTGAAAGATAACCGGATGGTGAAAACTGTTTGGATTTAACAGATTCACTTGGTATTTCCAAAGTTCCTTGTGGCCTACCATGTACAAATGATGCTTCACGACTGTCAAAGGATAAGGTTGCACTGCTGGAAGGCCAGCCCAAGCAGTCACTAAGGTCC-A			Likely benign (Mar 16, 2023)
15-48737994-A-G		Seckel syndrome 5 • Microcephaly 9, primary, autosomal recessive	Conflicting classifications of pathogenicity (Jan 12, 2018)
15-48738018-G-A		Primary Microcephaly, Recessive • Seckel syndrome	Uncertain significance (Jun 14, 2016)
15-48738055-C-T		Microcephaly 9, primary, autosomal recessive • Seckel syndrome 5	Benign/Likely benign (Oct 21, 2018)
15-48738079-A-G		Microcephaly 9, primary, autosomal recessive • Seckel syndrome 5	Benign/Likely benign (Jul 09, 2018)
15-48738176-T-G		Microcephaly 9, primary, autosomal recessive • Seckel syndrome 5	Uncertain significance (Jan 13, 2018)
15-48738198-C-T		Seckel syndrome 5 • Microcephaly 9, primary, autosomal recessive	Uncertain significance (Jan 12, 2018)
15-48738216-T-C		Seckel syndrome 5 • Microcephaly 9, primary, autosomal recessive	Uncertain significance (Jan 12, 2018)
15-48738242-A-G		Seckel syndrome 5 • Microcephaly 9, primary, autosomal recessive	Uncertain significance (Jan 12, 2018)
15-48738244-C-T		Microcephaly 9, primary, autosomal recessive • CEP152-related disorder	Uncertain significance (Mar 04, 2013)
15-48738251-A-T		CEP152-related disorder	Uncertain significance (May 22, 2017)
15-48738254-C-T		not specified	Uncertain significance (Mar 12, 2021)
15-48738257-G-A			Likely benign (Dec 01, 2023)
15-48738267-T-C		Microcephaly 9, primary, autosomal recessive • Seckel syndrome 5 • CEP152-related disorder	Conflicting classifications of pathogenicity (Jan 30, 2024)
15-48738270-G-A		CEP152-related disorder	Likely benign (Apr 23, 2023)
15-48738275-C-A		Microcephaly 9, primary, autosomal recessive	Uncertain significance (Mar 04, 2013)
15-48738279-G-A			Likely benign (Nov 20, 2023)
15-48738288-T-C			Likely benign (May 13, 2023)
15-48738295-C-T		not specified	Uncertain significance (Nov 29, 2018)
15-48738300-T-C			Likely benign (Nov 07, 2023)
15-48738303-C-T		not specified	Benign/Likely benign (Jan 18, 2024)
15-48738304-G-A		not specified • Seckel syndrome 5 • Microcephaly 9, primary, autosomal recessive	Benign/Likely benign (Jan 31, 2024)
15-48738305-G-A			Uncertain significance (Aug 19, 2022)
15-48738308-CAATT-C		Microcephaly 9, primary, autosomal recessive	Pathogenic (-)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CEP152	protein_coding	protein_coding	ENST00000380950	26	98219

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
2.66e-27	0.965	124446	0	349	124795	0.00140

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.0279	831	833	0.997	0.0000421	11378
Missense in Polyphen		272	275.17	0.98849		3976
Synonymous	-0.329	305	298	1.02	0.0000155	2973
Loss of Function	2.91	56	85.0	0.659	0.00000447	1047

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00379	0.00379
Ashkenazi Jewish	0.000794	0.000795
East Asian	0.00373	0.00362
Finnish	0.000329	0.000325
European (Non-Finnish)	0.00116	0.00111
Middle Eastern	0.00373	0.00362
South Asian	0.00177	0.00177
Other	0.00165	0.00165

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Necessary for centrosome duplication; the function seems also to involve CEP63, CDK5RAP2 and WDR62 through a stepwise assembled complex at the centrosome that recruits CDK2 required for centriole duplication (PubMed:26297806). Acts as a molecular scaffold facilitating the interaction of PLK4 and CENPJ, 2 molecules involved in centriole formation (PubMed:21059844, PubMed:20852615). Proposed to snatch PLK4 away from PLK4:CEP92 complexes in early G1 daughter centriole and to reposition PLK4 at the outer boundary of a newly forming CEP152 ring structure (PubMed:24997597). Also plays a key role in deuterosome-mediated centriole amplification in multiciliated that can generate more than 100 centrioles (By similarity). Overexpression of CEP152 can drive amplification of centrioles (PubMed:20852615). {ECO:0000250|UniProtKB:A2AUM9, ECO:0000250|UniProtKB:Q498G2, ECO:0000269|PubMed:20852615, ECO:0000269|PubMed:21059844, ECO:0000269|PubMed:21131973}.
• Disease: DISEASE: Microcephaly 9, primary, autosomal recessive (MCPH9) [MIM:614852]: A disease defined as a head circumference more than 3 standard deviations below the age-related mean. Brain weight is markedly reduced and the cerebral cortex is disproportionately small. Despite this marked reduction in size, the gyral pattern is relatively well preserved, with no major abnormality in cortical architecture. Affected individuals are mentally retarded. Primary microcephaly is further defined by the absence of other syndromic features or significant neurological deficits due to degenerative brain disorder. {ECO:0000269|PubMed:20598275}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Seckel syndrome 5 (SCKL5) [MIM:613823]: A rare autosomal recessive disorder characterized by proportionate dwarfism of prenatal onset associated with low birth weight, growth retardation, severe microcephaly with a bird-headed like appearance, and mental retardation. {ECO:0000269|PubMed:21131973}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Regulation of PLK1 Activity at G2/M Transition;Recruitment of mitotic centrosome proteins and complexes;Loss of Nlp from mitotic centrosomes;Loss of proteins required for interphase microtubule organization from the centrosome;Centrosome maturation;AURKA Activation by TPX2;G2/M Transition;Mitotic G2-G2/M phases;Recruitment of NuMA to mitotic centrosomes;Mitotic Prometaphase;M Phase;Cell Cycle;Cell Cycle, Mitotic;Anchoring of the basal body to the plasma membrane;Cilium Assembly;Organelle biogenesis and maintenance (Consensus)

Recessive Scores

• pRec: 0.100

Intolerance Scores

• loftool: 0.979
• rvis_EVS: 0.97
• rvis_percentile_EVS: 90.24

Haploinsufficiency Scores

• pHI: 0.166
• hipred: N
• hipred_score: 0.230
• ghis: 0.567

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: E
• essential_gene_gene_trap: E
• gene_indispensability_pred: N
• gene_indispensability_score: 0.224

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Cep152
• Phenotype: embryo phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); cellular phenotype

Gene ontology

• Biological process: G2/M transition of mitotic cell cycle;centriole replication;regulation of G2/M transition of mitotic cell cycle;centrosome duplication;ciliary basal body-plasma membrane docking;de novo centriole assembly involved in multi-ciliated epithelial cell differentiation
• Cellular component: pericentriolar material;nucleoplasm;centrosome;centriole;cytosol;deuterosome
• Molecular function: protein binding;protein kinase binding