COL4A2

collagen type IV alpha 2 chain, the group of Collagens|MicroRNA protein coding host genes

Basic information

Region (hg38): 13:110305812-110513209

Links

ENSG00000134871 ∙ NCBI:1284 ∙ OMIM:120090 ∙ HGNC:2203 ∙ Uniprot:P08572 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• familial porencephaly (Supportive), mode of inheritance: AD
• COL4A1 or COL4A2-related cerebral small vessel disease (Moderate), mode of inheritance: AD
• porencephaly 2 (Moderate), mode of inheritance: AD
• porencephaly 2 (Strong), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Hemorrhage, intracerebral, susceptibility to	AD	Cardiovascular	The awareness that individuals are at risk for hemorrhagic stroke may allow preventive management related to contributory factors, which may decrease morbidity/mortality.	Cardiovascular	22209247; 22209246
Authors have suggested that reported nonglycine variants may result in milder disease later in life or cause disease due to interactions with other factors.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the COL4A2 gene.

• not provided (28 variants)
• Porencephaly 2 (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the COL4A2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			5	208	31	244
missense	1	23	449	53	17	543
nonsense	9	4	11			24
start loss						0
frameshift	17	2	13			32
inframe indel		1	4			5
splice donor/acceptor (+/-2bp)	3	11	11		3	28
splice region			42	43	9	94
non coding			29	192	248	469
Total	30	41	522	453	299

Highest pathogenic variant AF is 0.0000263

Variants in COL4A2

This is a list of pathogenic ClinVar variants found in the COL4A2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
13-110306784-A-G			Benign (Jul 09, 2018)
13-110306931-G-A		Hemorrhage, intracerebral, susceptibility to;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant;Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Retinal arterial tortuosity;Brain small vessel disease 1 with or without ocular anomalies	Uncertain significance (Apr 15, 2024)
13-110306935-G-C		COL4A1-related disorder	Likely benign (Jan 25, 2024)
13-110306941-C-CA		COL4A1-related disorder	Uncertain significance (Dec 11, 2023)
13-110306944-C-T		Hemorrhage, intracerebral, susceptibility to;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant;Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Retinal arterial tortuosity;Brain small vessel disease 1 with or without ocular anomalies	Uncertain significance (Mar 07, 2024)
13-110306946-T-C		Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome • Porencephalic cyst • Brain small vessel disease 1 with or without ocular anomalies • not specified	Uncertain significance (Sep 03, 2024)
13-110306953-G-A			Likely benign (Mar 22, 2023)
13-110306953-GGCCCGGCTGTGCTCCTCGTGGAGCAGAAGGGCGGCGGGCAGCAGCAGCAGCCAGACGCTGAGCCGGGGCCCCATGGTGGCGCGCCCGAGGCGGCGAGGGACGGCT-G			Pathogenic (Oct 30, 2023)
13-110306954-G-C		Brain small vessel disease 1 with or without ocular anomalies;Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Hemorrhage, intracerebral, susceptibility to;Retinal arterial tortuosity;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant	Uncertain significance (Apr 22, 2024)
13-110306957-C-G			Uncertain significance (May 08, 2024)
13-110306958-G-A			Uncertain significance (Jun 05, 2023)
13-110306958-G-C			Uncertain significance (Jul 05, 2022)
13-110306961-T-C			Uncertain significance (Aug 20, 2022)
13-110306964-G-A			Uncertain significance (May 25, 2023)
13-110306966-T-A			Uncertain significance (Jul 11, 2022)
13-110306969-T-C		Hemorrhage, intracerebral, susceptibility to;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant;Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Retinal arterial tortuosity;Brain small vessel disease 1 with or without ocular anomalies	Uncertain significance (Jan 18, 2024)
13-110306972-T-A		Inborn genetic diseases	Uncertain significance (Dec 07, 2024)
13-110306972-T-G			Uncertain significance (Feb 08, 2024)
13-110306975-A-G		Inborn genetic diseases	Uncertain significance (Jan 31, 2024)
13-110306982-G-C			Uncertain significance (Mar 18, 2023)
13-110306984-G-A		Inborn genetic diseases • Microangiopathy and leukoencephalopathy, pontine, autosomal dominant;Hemorrhage, intracerebral, susceptibility to;Retinal arterial tortuosity;Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Brain small vessel disease 1 with or without ocular anomalies	Uncertain significance (Jun 17, 2024)
13-110306985-C-T		Brain small vessel disease 1 with or without ocular anomalies;Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Retinal arterial tortuosity;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant;Hemorrhage, intracerebral, susceptibility to	Uncertain significance (Oct 28, 2024)
13-110306987-G-A		Autosomal dominant familial hematuria-retinal arteriolar tortuosity-contractures syndrome;Microangiopathy and leukoencephalopathy, pontine, autosomal dominant;Brain small vessel disease 1 with or without ocular anomalies;Retinal arterial tortuosity;Hemorrhage, intracerebral, susceptibility to	Uncertain significance (Dec 19, 2024)
13-110306988-C-A		Inborn genetic diseases	Uncertain significance (Dec 10, 2021)
13-110306989-G-A			Likely benign (Jan 18, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
COL4A2	protein_coding	protein_coding	ENST00000360467	47	207216

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
3.58e-15	1.00	124696	0	143	124839	0.000573

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	2.19	842	1.04e+3	0.809	0.0000612	10679
Missense in Polyphen		114	267.14	0.42675		2513
Synonymous	0.829	398	420	0.949	0.0000284	3776
Loss of Function	4.81	40	89.0	0.450	0.00000450	1068

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000935	0.000917
Ashkenazi Jewish	0.000302	0.000298
East Asian	0.000457	0.000445
Finnish	0.000790	0.000789
European (Non-Finnish)	0.000634	0.000618
Middle Eastern	0.000457	0.000445
South Asian	0.000703	0.000686
Other	0.000165	0.000165

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Type IV collagen is the major structural component of glomerular basement membranes (GBM), forming a 'chicken-wire' meshwork together with laminins, proteoglycans and entactin/nidogen.
• Disease: DISEASE: Porencephaly 2 (POREN2) [MIM:614483]: A neurologic disorder characterized by a fluid-filled cysts or cavities within the cerebral hemispheres. Affected individuals typically have hemiplegia, seizures, and intellectual disability. Porencephaly type 2, or schizencephalic porencephaly, is usually symmetric and represents a primary defect in the development of the cerebral ventricles. {ECO:0000269|PubMed:22209246}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Intracerebral hemorrhage (ICH) [MIM:614519]: A pathological condition characterized by bleeding into one or both cerebral hemispheres including the basal ganglia and the cerebral cortex. It is often associated with hypertension and craniocerebral trauma. Intracerebral bleeding is a common cause of stroke. {ECO:0000269|PubMed:22209247}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.
• Pathway: PI3K-Akt signaling pathway - Homo sapiens (human);ECM-receptor interaction - Homo sapiens (human);Focal adhesion - Homo sapiens (human);Relaxin signaling pathway - Homo sapiens (human);AGE-RAGE signaling pathway in diabetic complications - Homo sapiens (human);Small cell lung cancer - Homo sapiens (human);Protein digestion and absorption - Homo sapiens (human);Amoebiasis - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Human papillomavirus infection - Homo sapiens (human);Platelet Aggregation Inhibitor Pathway, Pharmacodynamics;miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;miRNA targets in ECM and membrane receptors;Focal Adhesion;Hepatitis C and Hepatocellular Carcinoma;Focal Adhesion-PI3K-Akt-mTOR-signaling pathway;Protein alkylation leading to liver fibrosis;PI3K-Akt Signaling Pathway;EMT transition in Colorectal Cancer;Developmental Biology;Assembly of collagen fibrils and other multimeric structures;Signal Transduction;regulators of bone mineralization;Vesicle-mediated transport;intrinsic prothrombin activation pathway;Collagen chain trimerization;Collagen biosynthesis and modifying enzymes;Integrin cell surface interactions;Signaling by PDGF;Collagen formation;Extracellular matrix organization;Integrin;NCAM signaling for neurite out-growth;NCAM1 interactions;Axon guidance;Binding and Uptake of Ligands by Scavenger Receptors;Signaling by Receptor Tyrosine Kinases;Scavenging by Class A Receptors (Consensus)

Intolerance Scores

• loftool: 0.0908
• rvis_EVS: -0.64
• rvis_percentile_EVS: 16.53

Haploinsufficiency Scores

• pHI: 0.268
• hipred: Y
• hipred_score: 0.623
• ghis: 0.573

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.540

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Col4a2
• Phenotype: skeleton phenotype; immune system phenotype; vision/eye phenotype; digestive/alimentary phenotype; limbs/digits/tail phenotype; hearing/vestibular/ear phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); neoplasm; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; reproductive system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); respiratory system phenotype; embryo phenotype; homeostasis/metabolism phenotype; craniofacial phenotype; muscle phenotype; endocrine/exocrine gland phenotype; growth/size/body region phenotype

Gene ontology

• Biological process: angiogenesis;transcription, DNA-templated;aging;response to activity;negative regulation of angiogenesis;extracellular matrix organization;endodermal cell differentiation;collagen-activated tyrosine kinase receptor signaling pathway;cellular response to transforming growth factor beta stimulus
• Cellular component: extracellular region;collagen type IV trimer;extracellular space;endoplasmic reticulum lumen;extracellular matrix;collagen-containing extracellular matrix;extracellular exosome
• Molecular function: extracellular matrix structural constituent;protein binding;extracellular matrix structural constituent conferring tensile strength