CREBBP
CREB binding protein, the group of Bromodomain containing|Lysine acetyltransferases|Zinc fingers ZZ-type
Basic information
Region (hg38): 16:3725054-3880713
Previous symbols: [ "RSTS" ]
Links
Phenotypes
GenCC
Source:
- Rubinstein-Taybi syndrome (Definitive), mode of inheritance: AD
- Rubinstein-Taybi syndrome due to CREBBP mutations (Definitive), mode of inheritance: AD
- Rubinstein-Taybi syndrome due to CREBBP mutations (Strong), mode of inheritance: AD
- Menke-Hennekam syndrome 1 (Strong), mode of inheritance: AD
- Rubinstein-Taybi syndrome due to CREBBP mutations (Definitive), mode of inheritance: AD
- Menke-Hennekam syndrome 1 (Strong), mode of inheritance: AD
- Rubinstein-Taybi syndrome (Definitive), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Rubinstein-Taybi syndrome; Menke-Hennekam syndrome 1 | AD | Allergy/Immunology/Infectious; Audiologic/Otolaryngologic; Hematologic; Cardiovascular; Oncologic; Ophthalmologic | Rubinstein-Taybi syndrome can include a risk of frequent infections (especially respiratory infections), and prophylaxis and early and aggressive treatment of infections may be beneficial; There may be increased risk of malignancy, and awareness may allow early detection and treatment of oncologic processes; Due to the possibility of cardiovascular anomalies (including arrhythmia), surveillance may be beneficial; Surveillance for certain types of ophthalmologic manifestations (eg, glaucoma) may be beneficial in order to allow prompt treatment; Menke-Hennekam syndrome can include frequent infections, and prophylaxis and early and aggressive treatment of infections may be beneficial; Early recognition and treatment of hearing impairment may improve outcomes, including speech and language development | Allergy/Immunology/Infectious; Audiologic/Otolaryngologic; Cardiovascular; Craniofacial; Musculoskeletal; Neurologic ; Oncologic; Ophthalmologic | 13983033; 7137629; 7747773; 7630403; 10573006; 15706485; 16913274; 18792986; 19852432; 20301699; 20717166; 20949605; 21085895; 21189944; 22426292; 23432975; 27311832; 29460469; 30737887 |
ClinVar
This is a list of variants' phenotypes submitted to
- Rubinstein-Taybi syndrome due to CREBBP mutations (95 variants)
- Rubinstein-Taybi syndrome (82 variants)
- not provided (45 variants)
- Inborn genetic diseases (11 variants)
- CREBBP-related disorder (4 variants)
- Menke-Hennekam syndrome 1 (3 variants)
- Abnormal cerebral morphology (1 variants)
- Menke-Hennekam syndrome (1 variants)
- Rubinstein-Taybi syndrome due to CREBBP mutations;Menke-Hennekam syndrome 1 (1 variants)
- Corpus callosum, agenesis of (1 variants)
- Neurodevelopmental disorder (1 variants)
- See cases (1 variants)
- Intellectual disability (1 variants)
- Scoliosis;Global developmental delay (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the CREBBP gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 11 | 415 | 46 | 472 | ||
| missense | 22 | 66 | 619 | 119 | 40 | 866 |
| nonsense | 71 | 80 | ||||
| start loss | 1 | |||||
| frameshift | 99 | 21 | 122 | |||
| inframe indel | 32 | 48 | ||||
| splice donor/acceptor (+/-2bp) | 21 | 15 | 37 | |||
| splice region | 2 | 2 | 23 | 53 | 2 | 82 |
| non coding | 152 | 47 | 205 | |||
| Total | 215 | 116 | 673 | 694 | 133 |
Variants in CREBBP
This is a list of pathogenic ClinVar variants found in the CREBBP region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 16-3726789-T-C | Uncertain significance (Nov 09, 2023) | |||
| 16-3727471-AAACGGAAAAAAAAGAACCCCCCCCACCCCCCCGCCAAAAAAAAACCAAAGAGAGAGACCAGATATTTAAATCAACTGGTTTTTAACAAAAAAATATATTCTTTGTATTGTTTCTTTAAACATCAATCCACCCTTCCATGGCTCGGAAGTCGCAGTTCCATCTAGGAATAAAAAGAACCTAGATGCCTGGATTTTCAGTACAAAAGGTCCAAGAACATGAAAGGGAAAAGGTGATGCTCTCACAATGCTACAAGCCCTCCACAAACTTCTCTAGCGTGTCCCCCGTGGTGTCCCCGACCAGGGACAGTTCGCTGGA-G | Rubinstein-Taybi syndrome due to CREBBP mutations | Likely pathogenic (Sep 18, 2017) | ||
| 16-3727689-GA-G | Benign (Mar 03, 2015) | |||
| 16-3727692-A-AG | Benign (Mar 03, 2015) | |||
| 16-3727696-A-G | Benign (Mar 03, 2015) | |||
| 16-3727711-C-T | CREBBP-related disorder | Likely benign (May 29, 2024) | ||
| 16-3727721-C-T | Rubinstein-Taybi syndrome • CREBBP-related disorder | Benign (Sep 19, 2023) | ||
| 16-3727733-A-G | Inborn genetic diseases | Likely benign (Jan 06, 2020) | ||
| 16-3727736-C-A | Rubinstein-Taybi syndrome due to CREBBP mutations | Uncertain significance (May 03, 2018) | ||
| 16-3727745-C-T | not specified • Rubinstein-Taybi syndrome • Inborn genetic diseases • CREBBP-related disorder | Benign/Likely benign (Apr 01, 2024) | ||
| 16-3727745-C-CGTGTCCCCCGTG | Rubinstein-Taybi syndrome | Uncertain significance (Feb 14, 2023) | ||
| 16-3727747-T-C | Rubinstein-Taybi syndrome | Uncertain significance (Jan 01, 2023) | ||
| 16-3727754-C-T | not specified • Rubinstein-Taybi syndrome • CREBBP-related disorder | Likely benign (Jan 29, 2024) | ||
| 16-3727755-G-A | Rubinstein-Taybi syndrome | Likely benign (Oct 14, 2023) | ||
| 16-3727757-G-T | Likely benign (Jun 14, 2018) | |||
| 16-3727765-C-G | Uncertain significance (-) | |||
| 16-3727766-G-A | Rubinstein-Taybi syndrome • CREBBP-related disorder | Benign (Apr 12, 2022) | ||
| 16-3727770-A-T | Inborn genetic diseases • CREBBP-related disorder | Uncertain significance (Dec 28, 2023) | ||
| 16-3727775-C-A | Rubinstein-Taybi syndrome • CREBBP-related disorder | Likely benign (Jan 02, 2024) | ||
| 16-3727778-T-C | CREBBP-related disorder | Likely benign (Dec 05, 2022) | ||
| 16-3727781-G-A | CREBBP-related disorder | Likely benign (Aug 23, 2023) | ||
| 16-3727781-G-C | Rubinstein-Taybi syndrome | Uncertain significance (Dec 26, 2023) | ||
| 16-3727789-G-A | CREBBP-related disorder | Likely benign (Oct 09, 2021) | ||
| 16-3727790-C-T | Rubinstein-Taybi syndrome | Likely benign (Dec 18, 2023) | ||
| 16-3727791-G-A | Rubinstein-Taybi syndrome • CREBBP-related disorder | Benign/Likely benign (Jan 03, 2024) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| CREBBP | protein_coding | protein_coding | ENST00000262367 | 31 | 155673 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 1.00 | 1.51e-17 | 125720 | 0 | 28 | 125748 | 0.000111 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 3.90 | 1005 | 1.42e+3 | 0.709 | 0.0000896 | 15988 |
| Missense in Polyphen | 127 | 226.43 | 0.56089 | 2771 | ||
| Synonymous | -4.84 | 714 | 567 | 1.26 | 0.0000401 | 4824 |
| Loss of Function | 9.83 | 3 | 118 | 0.0253 | 0.00000679 | 1208 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.00291 | 0.00159 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000177 | 0.0000176 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.00 | 0.00 |
| Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Acetylates histones, giving a specific tag for transcriptional activation. Also acetylates non-histone proteins, like NCOA3 and FOXO1. Binds specifically to phosphorylated CREB and enhances its transcriptional activity toward cAMP-responsive genes. Acts as a coactivator of ALX1. Acts as a circadian transcriptional coactivator which enhances the activity of the circadian transcriptional activators: NPAS2-ARNTL/BMAL1 and CLOCK- ARNTL/BMAL1 heterodimers. Acetylates PCNA; acetylation promotes removal of chromatin-bound PCNA and its degradation during nucleotide excision repair (NER) (PubMed:24939902). Functions as a transcriptional coactivator for SMAD4 in the TGF-beta signaling pathway (PubMed:25514493). {ECO:0000269|PubMed:11154691, ECO:0000269|PubMed:12738767, ECO:0000269|PubMed:12929931, ECO:0000269|PubMed:14645221, ECO:0000269|PubMed:24939902, ECO:0000269|PubMed:25514493, ECO:0000269|PubMed:9707565}.;
- Disease
- DISEASE: Note=Chromosomal aberrations involving CREBBP may be a cause of acute myeloid leukemias. Translocation t(8;16)(p11;p13) with KAT6A; translocation t(11;16)(q23;p13.3) with KMT2A/MLL1; translocation t(10;16)(q22;p13) with KAT6B. KAT6A-CREBBP may induce leukemia by inhibiting RUNX1-mediated transcription.; DISEASE: Rubinstein-Taybi syndrome 1 (RSTS1) [MIM:180849]: A disorder characterized by craniofacial abnormalities, postnatal growth deficiency, broad thumbs, broad big toes, mental retardation and a propensity for development of malignancies. {ECO:0000269|PubMed:11331617, ECO:0000269|PubMed:12114483, ECO:0000269|PubMed:12566391, ECO:0000269|PubMed:15706485, ECO:0000269|PubMed:20684013, ECO:0000269|PubMed:24616510, ECO:0000269|PubMed:25388907}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=De novo missense mutations in the last part of exon 30 or beginning of exon 31 are associated with growth retardation, craniofacial dysmorphism and additional Rubinstein-Taybi-like features. No patients have broad thumbs. Patients have intellectual disability of variable severity, a marked speech delay, short stature and microcephaly. Main facial characteristics include short palpebral fissures, telecanthi, depressed nasal ridge, short nose, anteverted nares, short columella and long philtrum. {ECO:0000269|PubMed:27311832}.;
- Pathway
- Kaposi,s sarcoma-associated herpesvirus infection - Homo sapiens (human);TGF-beta signaling pathway - Homo sapiens (human);Renal cell carcinoma - Homo sapiens (human);Long-term potentiation - Homo sapiens (human);Adherens junction - Homo sapiens (human);Cell cycle - Homo sapiens (human);HIF-1 signaling pathway - Homo sapiens (human);Jak-STAT signaling pathway - Homo sapiens (human);Influenza A - Homo sapiens (human);Huntington,s disease - Homo sapiens (human);FoxO signaling pathway - Homo sapiens (human);HTLV-I infection - Homo sapiens (human);Glucagon signaling pathway - Homo sapiens (human);Thyroid hormone signaling pathway - Homo sapiens (human);Prostate cancer - Homo sapiens (human);cAMP signaling pathway - Homo sapiens (human);Tuberculosis - Homo sapiens (human);MicroRNAs in cancer - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Viral carcinogenesis - Homo sapiens (human);Hepatitis B - Homo sapiens (human);Wnt signaling pathway - Homo sapiens (human);Notch signaling pathway - Homo sapiens (human);Epstein-Barr virus infection - Homo sapiens (human);Melanogenesis - Homo sapiens (human);Human papillomavirus infection - Homo sapiens (human);Herpes simplex infection - Homo sapiens (human);Glucocorticoid Pathway (Peripheral Tissue), Pharmacodynamics;Androgen receptor signaling pathway;Angiogenesis;TNF alpha Signaling Pathway;Notch Signaling Pathway;Initiation of transcription and translation elongation at the HIV-1 LTR;IL-6 signaling pathway;Pathways Affected in Adenoid Cystic Carcinoma;Hematopoietic Stem Cell Gene Regulation by GABP alpha-beta Complex;TGF-beta Signaling Pathway;miRNA regulation of prostate cancer signaling pathways;Wnt Signaling Pathway and Pluripotency;Pathways in clear cell renal cell carcinoma;Ebola Virus Pathway on Host;Ebola Virus Pathway on Host;Type 2 papillary renal cell carcinoma;Notch Signaling Pathway;TGF-beta Receptor Signaling;Sudden Infant Death Syndrome (SIDS) Susceptibility Pathways;Developmental Biology;Disease;RUNX3 regulates NOTCH signaling;Signaling by WNT;Signal Transduction;Gene expression (Transcription);Transcriptional regulation by RUNX3;Attenuation phase;HSF1-dependent transactivation;mechanism of gene regulation by peroxisome proliferators via ppara;wnt signaling pathway;il-7 signal transduction;pelp1 modulation of estrogen receptor activity;acetylation and deacetylation of rela in nucleus;the information processing pathway at the ifn beta enhancer;transcription regulation by methyltransferase of carm1;activation of csk by camp-dependent protein kinase inhibits signaling through the t cell receptor;nfat and hypertrophy of the heart ;nfkb activation by nontypeable hemophilus influenzae;multi-step regulation of transcription by pitx2;carm1 and regulation of the estrogen receptor;Generic Transcription Pathway;Prolactin;Regulation of lipid metabolism by Peroxisome proliferator-activated receptor alpha (PPARalpha);Metabolism of lipids;IL12 signaling mediated by STAT4;Cellular responses to stress;TRAF6 mediated IRF7 activation;DDX58/IFIH1-mediated induction of interferon-alpha/beta;LRR FLII-interacting protein 1 (LRRFIP1) activates type I IFN production;TP53 Regulates Transcription of Cell Death Genes;CD209 (DC-SIGN) signaling;C-type lectin receptors (CLRs);RNA Polymerase II Transcription;Chromatin modifying enzymes;Notch-HLH transcription pathway;TCR;Notch;HIF-2-alpha transcription factor network;Hedgehog;Innate Immune System;Immune System;Metabolism;NICD traffics to nucleus;Transcriptional regulation of white adipocyte differentiation;TRAF3-dependent IRF activation pathway;Pre-NOTCH Transcription and Translation;Pre-NOTCH Expression and Processing;Signaling by NOTCH1;NOTCH3 Intracellular Domain Regulates Transcription;Signaling by NOTCH3;Signaling by NOTCH;TGF-beta super family signaling pathway canonical;TP53 Regulates Transcription of Genes Involved in Cytochrome C Release;HATs acetylate histones;regulation of transcriptional activity by pml;Cellular responses to external stimuli;TGF_beta_Receptor;inhibition of huntingtons disease neurodegeneration by histone deacetylase inhibitors;tgf beta signaling pathway;Glucocorticoid receptor regulatory network;Signaling events mediated by TCPTP;LIF signaling;FOXA1 transcription factor network;Cellular response to heat stress;Posttranslational regulation of adherens junction stability and dissassembly;Signaling by Nuclear Receptors;Chromatin organization;C-MYB transcription factor network;Activation of the TFAP2 (AP-2) family of transcription factors;Transcriptional Regulation by TP53;IFN-gamma pathway;Direct p53 effectors;IL4;Transcriptional regulation by the AP-2 (TFAP2) family of transcription factors;Estrogen-dependent gene expression;RUNX1 regulates transcription of genes involved in differentiation of myeloid cells;IL6;TNFalpha;Constitutive Signaling by NOTCH1 PEST Domain Mutants;Signaling by NOTCH1 PEST Domain Mutants in Cancer;Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants;Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer;Signaling by NOTCH1 in Cancer;Cytosolic sensors of pathogen-associated DNA ;BMP2 signaling TGF-beta MV;BMP signaling Dro;ESR-mediated signaling;Wnt Canonical;Notch-mediated HES/HEY network;Transcriptional regulation by RUNX1;Diseases of signal transduction;Validated targets of C-MYC transcriptional activation;Retinoic acid receptors-mediated signaling;Formation of the beta-catenin:TCF transactivating complex;TCF dependent signaling in response to WNT;HIF-1-alpha transcription factor network;Regulation of Androgen receptor activity;Signaling events mediated by Stem cell factor receptor (c-Kit);Signaling events mediated by HDAC Class III;FOXM1 transcription factor network;FoxO family signaling;Role of Calcineurin-dependent NFAT signaling in lymphocytes;Wnt Mammals;NOTCH1 Intracellular Domain Regulates Transcription;Regulation of retinoblastoma protein;Signaling events mediated by HDAC Class I;Hedgehog signaling events mediated by Gli proteins;Regulation of nuclear SMAD2/3 signaling;Presenilin action in Notch and Wnt signaling;E2F transcription factor network;p53 pathway
(Consensus)
Recessive Scores
- pRec
- 0.551
Intolerance Scores
- loftool
- 0.00110
- rvis_EVS
- -2.1
- rvis_percentile_EVS
- 1.54
Haploinsufficiency Scores
- pHI
- 1.00
- hipred
- Y
- hipred_score
- 0.783
- ghis
- 0.601
Essentials
- essential_gene_CRISPR
- E
- essential_gene_CRISPR2
- S
- essential_gene_gene_trap
- E
- gene_indispensability_pred
- E
- gene_indispensability_score
- 1.00
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Crebbp
- Phenotype
- homeostasis/metabolism phenotype; cellular phenotype; craniofacial phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); endocrine/exocrine gland phenotype; growth/size/body region phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); respiratory system phenotype; embryo phenotype; skeleton phenotype; immune system phenotype; digestive/alimentary phenotype; limbs/digits/tail phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); neoplasm; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); liver/biliary system phenotype;
Gene ontology
- Biological process
- negative regulation of transcription by RNA polymerase II;response to hypoxia;stimulatory C-type lectin receptor signaling pathway;regulation of transcription, DNA-templated;transcription initiation from RNA polymerase II promoter;protein acetylation;signal transduction;Notch signaling pathway;positive regulation of transcription of Notch receptor target;regulation of smoothened signaling pathway;viral process;histone acetylation;N-terminal peptidyl-lysine acetylation;regulation of lipid metabolic process;positive regulation of transforming growth factor beta receptor signaling pathway;protein destabilization;positive regulation of type I interferon production;cellular response to UV;homeostatic process;embryonic digit morphogenesis;regulation of apoptotic process;regulation of myeloid cell differentiation;positive regulation of Notch signaling pathway;positive regulation of transcription, DNA-templated;positive regulation of transcription by RNA polymerase II;rhythmic process;regulation of transcription from RNA polymerase II promoter in response to hypoxia;protein-containing complex assembly;regulation of cellular response to heat;beta-catenin-TCF complex assembly
- Cellular component
- histone acetyltransferase complex;nuclear chromatin;nucleus;nucleoplasm;cytoplasm;nuclear body
- Molecular function
- proximal promoter sequence-specific DNA binding;RNA polymerase II transcription factor binding;RNA polymerase II activating transcription factor binding;p53 binding;chromatin binding;damaged DNA binding;transcription coactivator activity;transcription corepressor activity;histone acetyltransferase activity;protein binding;transcription factor binding;zinc ion binding;acetyltransferase activity;peptide N-acetyltransferase activity;MRF binding