CRIPT

CXXC repeat containing interactor of PDZ3 domain

Basic information

Region (hg38): 2:46616415-46630176

Links

ENSG00000119878 ∙ NCBI:9419 ∙ OMIM:604594 ∙ HGNC:14312 ∙ Uniprot:Q9P021 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• short stature with microcephaly and distinctive facies (Limited), mode of inheritance: AR
• short stature with microcephaly and distinctive facies (Moderate), mode of inheritance: AR
• short stature with microcephaly and distinctive facies (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Rothmund-Thomson syndrome, type 3	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Craniofacial; Dermatologic; Musculoskeletal; Neurologic; Ophthalmologic	24389050; 27250922

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CRIPT gene.

• Short stature with microcephaly and distinctive facies (3 variants)
• not provided (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CRIPT gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				7	1	8
missense		1	22			23
nonsense	1					1
start loss						0
frameshift	3					3
inframe indel						0
splice donor/acceptor (+/-2bp)		2				2
splice region				6	1	7
non coding			3	7	9	19
Total	4	3	25	14	10

Highest pathogenic variant AF is 0.00000658

Variants in CRIPT

This is a list of pathogenic ClinVar variants found in the CRIPT region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-46616860-CGGCGAGCGCCGGCGGGTCGGGGCGCCAAGGCTCAGGGCTGCTTCGGCAATTCGCGGGGGTAGCTTGCACCTCGTGAGGCGAGACGCCGAGGGCGTCCAGCGGGGCTTACCTAACTCTCCCTCCCGCGGAAGGGAAGCGGGGAACTACTGCCTCCTACCATCAGGTACGACGGGCGGCCCAGGCCCACGCGCAGGCGCAGGGCTGTGGGGCGGAGACCCACGCCTAACAGCCAGTCGCAGAAAGGGAGGGGCGGGCAAAAGGGGCAGCGGCTTTCCAGGTTTGGGGTAGGCGGGAGTATGGGCTTAGAAGCCGGAAGTGGGTTGACGTAGCCCGGAAGGGGAATACTTCCAAGTTGTAGTGTTGTTGTTTTCAGCCTGCTGCTGCTGCTGCTGTTGCGGCTAGGGGAACCGTCGTGGGGAAGGATGGTGTGCGAAAAATGTGAGTTAAGGGGCCGCTTCTGCGGGAGGAGGAGGCTGGGAGAACCTAACTGAGCTCTCCCGGGAACTTTGCTTTCTCGTTGTTTTTTCTTCGCCCACAGGTCTCAGATTCTATCCGCTGTCTTTCTACCCTACCCTTTGACCATTTTTGCACCTCCCAACGACCATACAGTCCTATATATTTTGTACTCAGAATGGTCTCAGTTCTGCACCTCCTTGTCTATTTCTGTTGCCTTCCCCCAGCCCCAGATCTCATCAGCTCTCCTCCCATATAAAAATGTGCAGTTAAACCCCAACGACACCTTTCTGTCTTGGCAATTCTTGATCTTTCCTTTCTATTCATGTAAGAAGTATTGTTCTCCTGCCAAATGCTAGACACTAGAACCAAAGACTAAGGACTTTGCCTTATTCATTCTCATTAGTCATTATGCCAGGATATGGCTTAGAGTAAGCCCAGAAGATGCTTGAATTGAAAATCAACGTAAGTGCAAATTATTATTTCCCTAACTTAAAACCTTTAATAAATTCTCAGTGTGCAGAGAATAATTTGGGGATTCTATATTTGGAACCTGGCGTTCAGGACCCTCCACACTAAGGCCCCAACTTATTTTTCCAGCTTCATCTTCACTGAGGCTTATCCTCTTCACATTTTGACCAAACAAAATACTCTTTGTGCCCATGTGTACTCTAAGCTTTCTATGCCTTTCCTCAGAATGTGTCCTTTATCTAGTTTGCCTTCATCCTCTTTACTCCTTTTTGTTCACAGTCCTATTGCCACATATCCAAATCCTCTGTCTTGCCTTCTCCCCAAACTTTCTTTTCTTGGATTTCCTTAGCTAGGGTTATTTCTTCCTGCATGGAATTTCTTCTAGTACTTTAGCTGTCGATTATTAT-C		Rothmund-Thomson syndrome, type 3	Pathogenic (Dec 23, 2015)
2-46616943-A-AG			Benign (Jun 18, 2021)
2-46617080-C-CG			Benign (Jun 18, 2021)
2-46617108-G-T			Benign (Nov 10, 2018)
2-46617285-GGT-G		Rothmund-Thomson syndrome, type 3	Pathogenic (Mar 09, 2022)
2-46617290-G-A		Rothmund-Thomson syndrome, type 3	Likely pathogenic (Dec 23, 2015)
2-46617295-A-G		EBV-positive nodal T- and NK-cell lymphoma	Likely benign (-)
2-46617477-T-C			Benign (Jun 19, 2021)
2-46617518-C-G			Benign (Jun 18, 2021)
2-46618710-A-G			Benign (Jun 18, 2021)
2-46618758-A-G			Likely benign (Dec 11, 2023)
2-46618785-T-C			Uncertain significance (Feb 22, 2022)
2-46618802-C-G			Uncertain significance (Oct 19, 2022)
2-46618825-T-C			Likely benign (Nov 04, 2023)
2-46618827-G-A			Uncertain significance (May 26, 2022)
2-46618834-C-T			Likely benign (Nov 22, 2022)
2-46618839-G-A			Likely pathogenic (May 24, 2022)
2-46619614-TATTCTG-T			Likely benign (Jan 29, 2024)
2-46619622-T-TA			Likely benign (Nov 25, 2022)
2-46619626-G-A			Likely pathogenic (Mar 04, 2023)
2-46619631-T-C			Benign (Dec 22, 2023)
2-46619633-G-C		Inborn genetic diseases	Uncertain significance (Jul 13, 2021)
2-46619648-A-G			Uncertain significance (Aug 04, 2023)
2-46619669-CA-C		Rothmund-Thomson syndrome, type 3	Pathogenic (Dec 14, 2021)
2-46619669-C-CA			Pathogenic (Feb 11, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CRIPT	protein_coding	protein_coding	ENST00000238892	5	9327

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000978	0.603	125675	0	10	125685	0.0000398

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.395	57	49.2	1.16	0.00000217	661
Missense in Polyphen		16	17.571	0.91058		235
Synonymous	0.398	14	16.0	0.873	7.58e-7	166
Loss of Function	0.519	5	6.42	0.779	2.69e-7	92

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.0000556	0.0000544
Finnish	0.00	0.00
European (Non-Finnish)	0.0000715	0.0000704
Middle Eastern	0.0000556	0.0000544
South Asian	0.00	0.00
Other	0.000175	0.000163

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Involved in the cytoskeletal anchoring of DLG4 in excitatory synapses. {ECO:0000250|UniProtKB:Q792Q4}.
• Disease: DISEASE: Short stature with microcephaly and distinctive facies (SSMF) [MIM:615789]: A disease characterized by dwarfism, microcephaly, and distinctive facial dysmorphism involving frontal bossing, high forehead, sparse hair and eyebrows, telecanthus, mild proptosis, anteverted nares, and flat nasal bridge. {ECO:0000269|PubMed:24389050, ECO:0000269|PubMed:27250922}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Recessive Scores

• pRec: 0.113

Intolerance Scores

• loftool: 0.688
• rvis_EVS: -0.12
• rvis_percentile_EVS: 44.54

Haploinsufficiency Scores

• pHI: 0.148
• hipred: Y
• hipred_score: 0.679
• ghis: 0.660

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: E
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.914

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Cript
• Phenotype: mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan)

Gene ontology

• Biological process: cytoplasmic microtubule organization;protein localization to microtubule;establishment of protein localization;regulation of postsynaptic density protein 95 clustering
• Cellular component: fibrillar center;nucleus;nucleolus;cytoplasm;postsynaptic density;cell junction;dendrite;neuronal cell body;dendritic spine;dendritic shaft
• Molecular function: protein binding;microtubule binding;PDZ domain binding;protein-containing complex binding;scaffold protein binding