CRYBB1

crystallin beta B1, the group of Beta-gamma crystallins

Basic information

Region (hg38): 22:26599277-26618027

Links

ENSG00000100122 ∙ NCBI:1414 ∙ OMIM:600929 ∙ HGNC:2397 ∙ Uniprot:P53674 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• cataract 17 multiple types (Definitive), mode of inheritance: AD
• cataract 17 multiple types (Strong), mode of inheritance: AR
• cataract 17 multiple types (Moderate), mode of inheritance: Semidominant
• cataract - microcornea syndrome (Supportive), mode of inheritance: AD
• pulverulent cataract (Supportive), mode of inheritance: AD
• early-onset nuclear cataract (Supportive), mode of inheritance: AD
• cataract 17 multiple types (Strong), mode of inheritance: AD
• cataract 17 multiple types (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Cataract 17, multiple types	AD/AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Ophthalmologic	12360425; 17460281; 21972112

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CRYBB1 gene.

• Cataract 17 multiple types (53 variants)
• not provided (20 variants)
• Inborn genetic diseases (10 variants)
• not specified (2 variants)
• CRYBB1-related condition (1 variants)
• Cataract 17 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CRYBB1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			6	5		11
missense		4	28	2	1	35
nonsense			1			1
start loss						0
frameshift	1	1	2			4
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region			3			3
non coding			5	4	9	18
Total	1	5	42	11	10

Highest pathogenic variant AF is 0.0000197

Variants in CRYBB1

This is a list of pathogenic ClinVar variants found in the CRYBB1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
22-26599423-G-C		Cataract 17 multiple types	Uncertain significance (Jan 12, 2018)
22-26599492-A-G		Cataract 17 multiple types	Uncertain significance (Jul 28, 2023)
22-26599495-T-TG		Cataract 17 multiple types	Uncertain significance (Mar 12, 2022)
22-26599505-T-C		Cataract 17 multiple types • CRYBB1-related disorder	Conflicting classifications of pathogenicity (May 12, 2023)
22-26599532-G-A		Cataract 17 multiple types	Likely benign (Mar 18, 2022)
22-26599536-T-TG		Cataract 17 multiple types	Uncertain significance (Aug 26, 2021)
22-26599551-C-T		Cataract 17 multiple types	Likely pathogenic (May 02, 2023)
22-26599552-G-A		Cataract 17 multiple types • CRYBB1-related disorder	Uncertain significance (Jul 26, 2023)
22-26599557-C-T		not specified • Inborn genetic diseases	Uncertain significance (Jan 03, 2024)
22-26599561-G-T		Cataract 17 multiple types	Uncertain significance (Apr 27, 2017)
22-26599566-G-T		Cataract 17 multiple types	Likely pathogenic (May 08, 2024)
22-26599591-C-A		Cataract 17 multiple types	Pathogenic (Nov 01, 2002)
22-26599609-G-A		Cataract 17 multiple types	Uncertain significance (Apr 29, 2023)
22-26599642-C-T		Cataract 17 multiple types	Uncertain significance (Oct 16, 2020)
22-26599663-AG-A		Cataract 17 multiple types	Pathogenic (Jan 10, 2018)
22-26599676-G-T		Cataract 17 multiple types	Uncertain significance (Jan 13, 2018)
22-26601647-A-ATGTGGATAAACCATTCACCGTGTCGTACTAAGCTTGAGTTCTAACTAACATCAAGTAAGGATTGACTTCGAGAATTACTAGTGGTTACGAATTGTGACGGACAAGGACAGGGAGACACCAACAGAGACCCGGGAATCACTGAGGTATATTTTGTCCCTATCAGGTTCAGGGACAACCCGTCTCACCAACGGGATACAGTCGGACACACAGACTCCATCCCACCTCCCGTACGGGTCACCTGTATTCTAGGTGCGTCGAGCAAACGAGAATCAGAGGGGGGGAAACAGTTCGGACGTTTTCCAAGGTCAGTAGGACATAAGACTCGGTAAGGCTCT		Schizophrenia	Uncertain significance (Nov 11, 2022)
22-26601766-A-T			Benign (Jun 29, 2018)
22-26601909-C-T		Inborn genetic diseases	Uncertain significance (Aug 22, 2023)
22-26601925-A-G		Inborn genetic diseases	Likely benign (Nov 18, 2023)
22-26601942-G-A		Cataract 17 multiple types	Uncertain significance (Mar 13, 2022)
22-26601944-G-A		Cataract 17 multiple types • CRYBB1-related disorder	Likely benign (Jun 03, 2022)
22-26601946-C-G		Cataract 17 multiple types	Uncertain significance (Jul 28, 2023)
22-26601947-G-A		Cataract 17 multiple types	Likely benign (Jan 15, 2020)
22-26602004-T-A		Inborn genetic diseases	Uncertain significance (Oct 03, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CRYBB1	protein_coding	protein_coding	ENST00000215939	5	18811

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000701	0.925	125716	0	32	125748	0.000127

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.351	156	169	0.924	0.0000123	1632
Missense in Polyphen		51	57.285	0.89029		583
Synonymous	-0.0727	69	68.2	1.01	0.00000509	514
Loss of Function	1.58	7	13.2	0.530	8.53e-7	120

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000576	0.000575
Ashkenazi Jewish	0.00	0.00
East Asian	0.000272	0.000272
Finnish	0.0000927	0.0000924
European (Non-Finnish)	0.000114	0.000114
Middle Eastern	0.000272	0.000272
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Crystallins are the dominant structural components of the vertebrate eye lens.
• Disease: DISEASE: Cataract 17, multiple types (CTRCT17) [MIM:611544]: An opacification of the crystalline lens of the eye that frequently results in visual impairment or blindness. Opacities vary in morphology, are often confined to a portion of the lens, and may be static or progressive. In general, the more posteriorly located and dense an opacity, the greater the impact on visual function. CTRCT17 includes nuclear and pulverulent cataracts, among others. Nuclear cataracts affect the central nucleus of the eye, are often not highly visually significant. The density of the opacities varies greatly from fine dots to a dense, white and chalk-like, central cataract. The condition is usually bilateral. Nuclear cataracts are often combined with opacified cortical fibers encircling the nuclear opacity, which are referred to as cortical riders. Pulverulent cataracts are characterized by a dust-like, 'pulverised' appearance of the opacities which can be found in any part of the lens. {ECO:0000269|PubMed:12360425, ECO:0000269|PubMed:17460281, ECO:0000269|PubMed:23508780}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Note=CRYBB1 mutations may be a cause of congenital cataract and microcornea syndrome, a disease characterized by the association of congenital cataract and microcornea without any other systemic anomaly or dysmorphism. Clinical findings include a corneal diameter inferior to 10 mm in both meridians in an otherwise normal eye, and an inherited cataract, which is most often bilateral posterior polar with opacification in the lens periphery. The cataract progresses to form a total cataract after visual maturity has been achieved, requiring cataract extraction in the first to third decade of life (PubMed:16110300 and PubMed:21972112). {ECO:0000305|PubMed:16110300, ECO:0000305|PubMed:21972112}.

Recessive Scores

• pRec: 0.134

Intolerance Scores

• loftool: 0.713
• rvis_EVS: -0.23
• rvis_percentile_EVS: 37.32

Haploinsufficiency Scores

• pHI: 0.0635
• hipred: N
• hipred_score: 0.301
• ghis: 0.440

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.314

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Crybb1

Gene ontology

• Biological process: visual perception
• Molecular function: structural constituent of eye lens;protein binding