CTLA4

cytotoxic T-lymphocyte associated protein 4, the group of V-set domain containing|CD molecules

Basic information

Region (hg38): 2:203853888-203873965

Previous symbols: [ "CELIAC3", "IDDM12" ]

Links

ENSG00000163599 ∙ NCBI:1493 ∙ OMIM:123890 ∙ HGNC:2505 ∙ Uniprot:P16410 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency (Strong), mode of inheritance: AD
• autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency (Supportive), mode of inheritance: AD
• autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency (Strong), mode of inheritance: AD
• autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Immune dysregulation with autoimmunity, immunodeficiency, and lymphoproliferation (Autoimmune lymphoproliferative syndrome, type V)	AD	Allergy/Immunology/Infectious; Oncologic	Medical treatment (with immunosuppression) has been described as beneficial; The condition may involve frequent infections, and awareness may allow preventive measures and early and aggressive treatment of infections	Allergy/Immunology/Infectious; Hematologic; Oncologic; Renal	25213377; 25329329

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CTLA4 gene.

• Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency (20 variants)
• not provided (3 variants)
• CTLA4-related disorder (1 variants)
• Inborn genetic diseases (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CTLA4 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	42	1	45
missense	3	5	101	3	1	113
nonsense	8	1	2			11
start loss						0
frameshift	9	1	2			12
inframe indel		1	2			3
splice donor/acceptor (+/-2bp)	3	3	2			8
splice region			5	3		8
non coding			1	8	7	16
Total	23	11	112	53	9

Highest pathogenic variant AF is 0.00000657

Variants in CTLA4

This is a list of pathogenic ClinVar variants found in the CTLA4 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-203866281-T-TA			Benign (Sep 01, 2022)
2-203866796-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Benign (Dec 19, 2023)
2-203867481-CAGCCTAGTAGTTTTGGAGTTGTCAATGAAATGAATTGGACTGGATGGTTAAGGATGCCCAGAAGATTGAATAAAATTGGGATTTAGGAGGACCCTTGTACTCCAGGAAATTCTCCAAGTCTCCACTTAGTTATCCAGATCCTCAAAGTGAACATGAAGCTTCAGTTTCAAATTGAATACATTTTCCATCCATGGATTGGCTTGTTTTGTTCAGTTGAGTGCTTGAGGTTGTCTTTTCGACGTAACAGCTAAACCCACGGCTTCCTTTCTCGTAAAACCAAAACAAAAAGGCTTTCTATTCAAGTGCCTTCTGTGTGTGCACATGTGTAATACATATCTGGGATCAAAGCTATCTATATAAAGTCCTTGATTCTGTGTGGGTTCAAACACATTTCAAAGCTTCAGGATCCTGAAAGGTTTTGCTCTACTTCCTGAAGACCTGAACACCGCTCCCATAAAGCCATGGCTTGCCTTGGATTTCAGCGGCACAAGGCTCAGCTGAACCTGGCTACCAGGACCTGGCCCTGCACTCTCCTGTTTTTTCTTCTCTTCATCCCTGTCTTCTGCAAAGGTGAGTGAGACTTTTGGAGCATGAAGATGGAGGAGGTGTTTCTCCTACCTGGGTTTCATTTGTTTCAGCAGTCAAAGGCAGTGATTTATAGCAAAGCCAGAAGTTAAAGGTAAAACTCCAATCTGGCTTGGCTGGCTCTGTATTCCAGGGCCAGCAGGGAGCAGTTGGGCGGCAGCAAATAAGGCAAAGAGATAGCTCAGAACAGAGCGCCAGGTATTTAGTAGGGGCTTCATGAATGCATGTGAGTTGGTTTAGTAGAGAGACACAGGCAATTTCAGACCCTTCTATGAGACTGGAAGTGATTTAAGAGGGAAAGGATAGCCATAGTCCTGAATACATTTGAGCTGGGTTTCAGGATGAGCTCACAAGTTCCTTTAAAAAAAATTGACTTAAGCAAATCCTGGGAAGAGTTTTTTTGCTATACAATTCAAGGTTTTAAGGTCCTCGGATTCATATACTTTATAAATGAATTAGCCAGCTTGTTTAAAATGTAGGGAAATTGTGGGAAGAATGCCTTCTTTACTTAATTCAAGGTTTTAAGGTTCTCTTAATCAATTCTACTAGCTAATTAGCCAATTATTTAAAAATAAAAGTTTGAAATTGCCAAAAAAAAAAGACAAGGAAAAGGAAAGAAAGAAAGCCACCAGTCTGTTTGGCATACAATACTTAATTGTTGCCTGACCTACGTGTGGGTTTCAGATGCAGATCCTCAGTTTTCAGCTCTTCAGAGACTGACACCAGGTTTGTTACACGGCTTAAAATGATGAGTATATCCATTGAATCTCAACCTTATCTCTCTCTAGACCTTCTTGGTTAAGAAACCATGTAGTTTGTATGAAGTAGGTACTCAAAAGATATTTGATGATTTAATTTTTACTGGAGAAGAAATATTCATATATGTTTTCTTATTTTTACATGTTTTAAATATGTAAAGATTAAATAAACACTCTTAGAAGTATTTAAATTTCCTAAAGTAAATTTATCTCAACCAGTAACAGGACCCTCCCAATACTGGAAAGTTGAGTGTGACCGCATTTAGTGGTGATGAGTGTGAGCTTGCTTGGGGAGAGGGCAGGACATTTAGGATTTCTTAAGCTTAGAGTCAATACAATAAAGATTATTGAGTGCTCACTTGGGTGGGCTATAATCACTGCTCACAGGAGTTCATGAACCACAAGTAAAAGAGTGAGGAGATATGATTAGCTCACAAATAACTTTAATACAGAGCAGAAAGTAATGAACTACT-C		Inherited Immunodeficiency Diseases	Uncertain significance (Jan 01, 2019)
2-203867500-T-A			Benign (Jun 18, 2021)
2-203867624-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Benign (Dec 19, 2023)
2-203867939-A-G			Uncertain significance (Dec 19, 2017)
2-203867943-A-ATGGGT		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Pathogenic (Jan 03, 2019)
2-203867946-G-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Jan 03, 2024)
2-203867964-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency • CTLA4-related disorder	Uncertain significance (Jan 28, 2023)
2-203867965-G-A		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Aug 28, 2023)
2-203867965-G-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Nov 20, 2022)
2-203867972-G-A		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Likely benign (Apr 14, 2020)
2-203867975-TCAGCTGAACCTGGCTAC-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Pathogenic (Apr 02, 2019)
2-203867979-C-CCT		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsuffiency	Pathogenic (Jan 04, 2021)
2-203867984-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Likely benign (Dec 31, 2019)
2-203867991-A-G		Hashimoto thyroiditis, susceptibility to • Systemic lupus erythematosus, susceptibility to • Celiac disease, susceptibility to, 3 • • not specified • TYPE 1 DIABETES MELLITUS 12, SUSCEPTIBILITY TO • Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Benign (Feb 01, 2024)
2-203867992-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Nov 04, 2023)
2-203867998-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Jan 05, 2023)
2-203868002-G-A		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Pathogenic/Likely pathogenic (Sep 25, 2024)
2-203868004-C-G		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Oct 09, 2023)
2-203868005-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Likely benign (Sep 21, 2021)
2-203868009-ACT-A		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Pathogenic (Jun 28, 2021)
2-203868010-C-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Uncertain significance (Apr 06, 2020)
2-203868016-TG-T		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency	Pathogenic (Sep 26, 2014)
2-203868017-G-C		Autoimmune lymphoproliferative syndrome due to CTLA4 haploinsufficiency • not specified	Benign (Jan 22, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CTLA4	protein_coding	protein_coding	ENST00000302823	4	6175

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.941	0.0589	125708	0	1	125709	0.00000398

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.69	74	128	0.580	0.00000683	1458
Missense in Polyphen		8	37.48	0.21345		416
Synonymous	0.648	45	50.9	0.884	0.00000301	454
Loss of Function	2.77	0	8.96	0.00	4.66e-7	101

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00000880	0.00000880
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Inhibitory receptor acting as a major negative regulator of T-cell responses. The affinity of CTLA4 for its natural B7 family ligands, CD80 and CD86, is considerably stronger than the affinity of their cognate stimulatory coreceptor CD28. {ECO:0000269|PubMed:16551244, ECO:0000269|PubMed:1714933}.
• Disease: DISEASE: Systemic lupus erythematosus (SLE) [MIM:152700]: A chronic, relapsing, inflammatory, and often febrile multisystemic disorder of connective tissue, characterized principally by involvement of the skin, joints, kidneys and serosal membranes. It is of unknown etiology, but is thought to represent a failure of the regulatory mechanisms of the autoimmune system. The disease is marked by a wide range of system dysfunctions, an elevated erythrocyte sedimentation rate, and the formation of LE cells in the blood or bone marrow. {ECO:0000269|PubMed:15138458, ECO:0000269|PubMed:15688186}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Note=Genetic variations in CTLA4 may influence susceptibility to Graves disease, an autoimmune disorder associated with overactivity of the thyroid gland and hyperthyroidism. {ECO:0000269|PubMed:10924276}.; DISEASE: Diabetes mellitus, insulin-dependent, 12 (IDDM12) [MIM:601388]: A multifactorial disorder of glucose homeostasis that is characterized by susceptibility to ketoacidosis in the absence of insulin therapy. Clinical features are polydipsia, polyphagia and polyuria which result from hyperglycemia-induced osmotic diuresis and secondary thirst. These derangements result in long-term complications that affect the eyes, kidneys, nerves, and blood vessels. {ECO:0000269|PubMed:9259273}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Celiac disease 3 (CELIAC3) [MIM:609755]: A multifactorial, chronic disorder of the small intestine caused by intolerance to gluten. It is characterized by immune-mediated enteropathy associated with failed intestinal absorption, and malnutrition. In predisposed individuals, the ingestion of gluten- containing food such as wheat and rye induces a flat jejunal mucosa with infiltration of lymphocytes. {ECO:0000269|PubMed:10189842, ECO:0000269|PubMed:15657618}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Autoimmune lymphoproliferative syndrome 5 (ALPS5) [MIM:616100]: An autosomal dominant primary immunodeficiency characterized by severe autoimmunity, infiltration of non-lymphoid organs, such as the intestine, lungs and brain, by hyperactive T cells and B cells, autoimmune cytopenias, and hypogammaglobulinemia in early childhood. {ECO:0000269|PubMed:25213377, ECO:0000269|PubMed:25329329}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Cell adhesion molecules (CAMs) - Homo sapiens (human);T cell receptor signaling pathway - Homo sapiens (human);Autoimmune thyroid disease - Homo sapiens (human);Rheumatoid arthritis - Homo sapiens (human);Allograft Rejection;T-Cell Receptor and Co-stimulatory Signaling;Vitamin D Receptor Pathway;T-Cell antigen Receptor (TCR) pathway during Staphylococcus aureus infection;RUNX1 and FOXP3 control the development of regulatory T lymphocytes (Tregs);Gene expression (Transcription);the co-stimulatory signal during t-cell activation;Generic Transcription Pathway;CTLA4 inhibitory signaling;Costimulation by the CD28 family;RNA Polymerase II Transcription;TCR;Immune System;Adaptive Immune System;RUNX1 and FOXP3 control the development of regulatory T lymphocytes (Tregs);Transcriptional regulation by RUNX1;Calcineurin-regulated NFAT-dependent transcription in lymphocytes (Consensus)

Recessive Scores

• pRec: 0.752

Intolerance Scores

• loftool: 0.180
• rvis_EVS: -0.01
• rvis_percentile_EVS: 53.19

Haploinsufficiency Scores

• pHI: 0.599
• hipred: N
• hipred_score: 0.360
• ghis: 0.386

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.746

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Ctla4
• Phenotype: digestive/alimentary phenotype; immune system phenotype; skeleton phenotype; respiratory system phenotype; liver/biliary system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; pigmentation phenotype; endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan)

Gene ontology

• Biological process: adaptive immune response;immune response;cellular response to DNA damage stimulus;negative regulation of B cell proliferation;T cell costimulation;regulation of T cell proliferation;positive regulation of apoptotic process;regulation of regulatory T cell differentiation;negative regulation of regulatory T cell differentiation;B cell receptor signaling pathway
• Cellular component: Golgi apparatus;plasma membrane;integral component of plasma membrane;external side of plasma membrane;clathrin-coated endocytic vesicle;perinuclear region of cytoplasm;protein complex involved in cell adhesion
• Molecular function: protein binding