CTNNA1

catenin alpha 1, the group of Alpha catenins

Basic information

Region (hg38): 5:138610967-138935034

Links

ENSG00000044115 ∙ NCBI:1495 ∙ OMIM:116805 ∙ HGNC:2509 ∙ Uniprot:P35221 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• patterned macular dystrophy (Supportive), mode of inheritance: AD
• patterned macular dystrophy 2 (Definitive), mode of inheritance: AD
• patterned macular dystrophy 2 (Strong), mode of inheritance: AD
• hereditary nonpolyposis colon cancer (No Known Disease Relationship), mode of inheritance: AD
• CTNNA1-related diffuse gastric and lobular breast cancer syndrome (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Hereditary diffuse gastric cancer, familial	AD	Oncologic	Awareness of disease risk may allow surveillance for and early treatment of neoplastic disease, which may reduce morbidity and mortality	Oncologic; Ophthalmologic	5442145; 23208944; 26182300; 26691986; 29330337; 30515673

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CTNNA1 gene.

• not provided (69 variants)
• Hereditary diffuse gastric adenocarcinoma (28 variants)
• Polyposis syndrome, hereditary mixed, 1 (1 variants)
• Colorectal cancer (1 variants)
• Patterned macular dystrophy 2 (1 variants)
• Hereditary breast ovarian cancer syndrome (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CTNNA1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			7	653	5	665
missense			1211	12	1	1224
nonsense	33	2	17			52
start loss			4			4
frameshift	58	8	33			99
inframe indel			22			22
splice donor/acceptor (+/-2bp)		16	10	1		27
splice region			69	97	1	167
non coding			32	273	30	335
Total	91	26	1336	939	36

Variants in CTNNA1

This is a list of pathogenic ClinVar variants found in the CTNNA1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
5-138753397-G-A			Benign (Aug 15, 2019)
5-138753541-G-C		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138753726-G-A			Likely benign (Jul 15, 2018)
5-138753833-G-A		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138753949-T-C		Hereditary cancer-predisposing syndrome	Likely benign (-)
5-138754059-A-C		Hereditary cancer-predisposing syndrome	Likely benign (-)
5-138762375-C-T		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138762641-G-T		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138763637-C-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138770269-G-A		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138771865-A-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138772249-A-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138772399-C-T		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138772458-T-C		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138772509-C-T		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138772560-A-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138772576-A-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138775254-C-T		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138776155-AAAGGTCTCTGGTTTTCCTATGCAGAGGACCCTGCGGCCTTCCGCAGTGTTTGTGTCCCTGGGTACTTGAGATTAGGGAGTGGTGATGACTCTTAACGAGCATGCTGCCTTCAAGCATCTGTTCAACAAAGCACATCTTGCACCACCTCAATCCATTCAACCCTGAGTGGACACACCACATGTTTCAGAGAGCAC-A		Schizophrenia	Uncertain significance (Nov 11, 2022)
5-138781015-C-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138781020-A-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138781152-C-G		Hereditary cancer-predisposing syndrome	Likely benign (Dec 01, 2015)
5-138781925-A-G			Uncertain significance (Jun 29, 2023)
5-138781926-T-C			Uncertain significance (Dec 15, 2022)
5-138781928-A-G		Hereditary cancer-predisposing syndrome	Uncertain significance (Nov 14, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CTNNA1	protein_coding	protein_coding	ENST00000302763	17	324068

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.970	0.0304	125728	0	20	125748	0.0000795

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.66	294	532	0.553	0.0000306	5977
Missense in Polyphen		52	151.07	0.3442		1782
Synonymous	0.113	196	198	0.990	0.0000116	1737
Loss of Function	5.20	8	46.1	0.174	0.00000258	512

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000120	0.000119
Ashkenazi Jewish	0.00	0.00
East Asian	0.0000544	0.0000544
Finnish	0.00	0.00
European (Non-Finnish)	0.0000972	0.0000967
Middle Eastern	0.0000544	0.0000544
South Asian	0.0000991	0.0000980
Other	0.000326	0.000326

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Associates with the cytoplasmic domain of a variety of cadherins. The association of catenins to cadherins produces a complex which is linked to the actin filament network, and which seems to be of primary importance for cadherins cell-adhesion properties. Can associate with both E- and N-cadherins. Originally believed to be a stable component of E-cadherin/catenin adhesion complexes and to mediate the linkage of cadherins to the actin cytoskeleton at adherens junctions. In contrast, cortical actin was found to be much more dynamic than E-cadherin/catenin complexes and CTNNA1 was shown not to bind to F-actin when assembled in the complex suggesting a different linkage between actin and adherens junctions components. The homodimeric form may regulate actin filament assembly and inhibit actin branching by competing with the Arp2/3 complex for binding to actin filaments. May play a crucial role in cell differentiation. {ECO:0000269|PubMed:25653389}.
• Disease: DISEASE: Note=Germline CTNNA1 truncating mutations have been detected in patients with hereditary diffuse gastric cancer (HDGC) and may play a role in disease susceptibility. Diffuse gastric cancer is a malignant disease characterized by poorly differentiated infiltrating lesions resulting in thickening of the stomach. Malignant tumors start in the stomach, can spread to the esophagus or the small intestine, and can extend through the stomach wall to nearby lymph nodes and organs. It also can metastasize to other parts of the body. {ECO:0000269|PubMed:23208944, ECO:0000269|PubMed:26182300}.; DISEASE: Macular dystrophy, patterned, 2 (MDPT2) [MIM:608970]: A form of retinal patterned dystrophy, a heterogeneous group of macular disorders caused by abnormal accumulation of lipofuscin in the retinal pigment epithelium. Lipofuscin distribution can show various shapes that define different types of macular dystrophy, including reticular (fishnet-like) dystrophy, macroreticular (spider-shaped) dystrophy and butterfly-shaped pigment dystrophy. MDPT2 is an autosomal dominant form characterized by bilateral accumulation of pigment in the macular area that resembles the wings of a butterfly. {ECO:0000269|PubMed:26691986}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Gastric cancer - Homo sapiens (human);Adherens junction - Homo sapiens (human);Arrhythmogenic right ventricular cardiomyopathy (ARVC) - Homo sapiens (human);Hippo signaling pathway - Homo sapiens (human);Bacterial invasion of epithelial cells - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Endometrial cancer - Homo sapiens (human);Leukocyte transendothelial migration - Homo sapiens (human);Arrhythmogenic Right Ventricular Cardiomyopathy;White fat cell differentiation;Apoptosis-related network due to altered Notch3 in ovarian cancer;VEGFA-VEGFR2 Signaling Pathway;White fat cell differentiation;Endometrial cancer;Developmental Biology;Signal Transduction;VEGFA-VEGFR2 Pathway;RHO GTPases activate IQGAPs;CDO in myogenesis;Myogenesis;RHO GTPase Effectors;Signaling by Rho GTPases;TGF_beta_Receptor;E-cadherin signaling in keratinocytes;Posttranslational regulation of adherens junction stability and dissassembly;Signaling by VEGF;Arf6 trafficking events;Cell-cell junction organization;Adherens junctions interactions;Cell junction organization;Signaling by Receptor Tyrosine Kinases;Cell-Cell communication;Stabilization and expansion of the E-cadherin adherens junction;RAC1 signaling pathway;Nectin adhesion pathway;CDC42 signaling events;Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met);N-cadherin signaling events;Signaling events mediated by VEGFR1 and VEGFR2;E-cadherin signaling in the nascent adherens junction;VEGFR2 mediated vascular permeability (Consensus)

Recessive Scores

• pRec: 0.221

Intolerance Scores

• loftool: 0.340
• rvis_EVS: -0.84
• rvis_percentile_EVS: 11.36

Haploinsufficiency Scores

• pHI: 0.456
• hipred: Y
• hipred_score: 0.696
• ghis: 0.625

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.987

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Ctnna1
• Phenotype: embryo phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); pigmentation phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); limbs/digits/tail phenotype; vision/eye phenotype; skeleton phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; endocrine/exocrine gland phenotype; muscle phenotype; craniofacial phenotype; cellular phenotype

Zebrafish Information Network

• Gene name: ctnna1
• Affected structure: portion of tissue
• Phenotype tag: abnormal
• Phenotype quality: broken

Gene ontology

• Biological process: ovarian follicle development;actin filament organization;cell adhesion;establishment or maintenance of cell polarity;negative regulation of neuroblast proliferation;aging;male gonad development;gap junction assembly;axon regeneration;adherens junction organization;cellular protein localization;odontogenesis of dentin-containing tooth;apical junction assembly;response to estrogen;positive regulation of smoothened signaling pathway;positive regulation of muscle cell differentiation;protein heterooligomerization;cellular response to indole-3-methanol;epithelial cell-cell adhesion;negative regulation of cell motility;negative regulation of integrin-mediated signaling pathway;negative regulation of extrinsic apoptotic signaling pathway in absence of ligand;positive regulation of extrinsic apoptotic signaling pathway in absence of ligand
• Cellular component: acrosomal vesicle;Golgi apparatus;cytosol;plasma membrane;cell-cell junction;zonula adherens;focal adhesion;intercalated disc;actin cytoskeleton;catenin complex;flotillin complex;lamellipodium;cell junction;intracellular membrane-bounded organelle
• Molecular function: RNA binding;structural molecule activity;protein binding;beta-catenin binding;vinculin binding;identical protein binding;gamma-catenin binding;cadherin binding;protein heterodimerization activity;actin filament binding