CXCR4

C-X-C motif chemokine receptor 4, the group of CD molecules|C-X-C motif chemokine receptors

Basic information

Region (hg38): 2:136114349-136119177

Links

ENSG00000121966 ∙ NCBI:7852 ∙ OMIM:162643 ∙ HGNC:2561 ∙ Uniprot:P61073 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• WHIM syndrome (Moderate), mode of inheritance: AD
• WHIM syndrome 1 (Strong), mode of inheritance: AD
• WHIM syndrome (Supportive), mode of inheritance: AD
• WHIM syndrome 1 (Definitive), mode of inheritance: AD
• WHIM syndrome (Definitive), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Warts, hypogammaglobulinemia, infections, and myelokathexis (WHIM) syndrome	AD	Allergy/Immunology/Infectious; Hematologic	Individuals can be susceptible to a number of types of infections as well as hematologic sequelae, and prophylaxis and medical management (eg, including HPV vaccine, GCSF, CXCR4 antagonists) and early and aggressive treatment of infections can be beneficial	Allergy/Immunology/Infectious; Dermatologic; Hematologic	889707; 2239986; 10767001; 12692554; 25662009; 30625055
Because of HPV infections, the condition may include oncologic manifestations

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the CXCR4 gene.

• Warts, hypogammaglobulinemia, infections, and myelokathexis (11 variants)
• not provided (5 variants)
• WHIM syndrome 1 (3 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the CXCR4 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				42	3	45
missense			68	3	3	74
nonsense	5	1	5			11
start loss						0
frameshift	9	4	4			17
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region				1		1
non coding			1	5	4	10
Total	14	5	78	50	10

Variants in CXCR4

This is a list of pathogenic ClinVar variants found in the CXCR4 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-136114874-T-C		Warts, hypogammaglobulinemia, infections, and myelokathexis	Uncertain significance (May 28, 2019)
2-136114886-T-C		Warts, hypogammaglobulinemia, infections, and myelokathexis	Uncertain significance (Aug 04, 2023)
2-136114893-C-CTCAGACTCAGTGGAAACAGATGAATGTCCACCTCGCTTTCCTTTGGAGAGGATCTTGAGGCTGGACCCTCTGCTCACAGAGGTGAGTGCGTGCTGGGCAGAGGTTTTAAATTTGGCTCCAAGGAAAGCATAGAGGATGGGGT		Warts, hypogammaglobulinemia, infections, and myelokathexis	Pathogenic (Aug 30, 2022)
2-136114896-A-G		Warts, hypogammaglobulinemia, infections, and myelokathexis	Likely benign (Oct 03, 2021)
2-136114899-CTCAG-C			Likely pathogenic (Nov 03, 2021)
2-136114901-C-A		WHIM syndrome 1	Pathogenic (May 01, 2003)
2-136114901-CAG-C		Warts, hypogammaglobulinemia, infections, and myelokathexis	Pathogenic (Jun 08, 2023)
2-136114902-A-G		Warts, hypogammaglobulinemia, infections, and myelokathexis	Likely benign (Jul 15, 2021)
2-136114906-G-T		Warts, hypogammaglobulinemia, infections, and myelokathexis	Uncertain significance (Sep 22, 2023)
2-136114910-CAG-C		Warts, hypogammaglobulinemia, infections, and myelokathexis • WHIM syndrome 1	Likely pathogenic (Mar 21, 2019)
2-136114912-G-GATGA			Pathogenic (Sep 06, 2018)
2-136114913-AT-A		Warts, hypogammaglobulinemia, infections, and myelokathexis	Pathogenic (Sep 15, 2023)
2-136114915-G-C		Warts, hypogammaglobulinemia, infections, and myelokathexis • WHIM syndrome 1	Pathogenic (Oct 01, 2021)
2-136114915-G-T		WHIM syndrome 1	Likely pathogenic (May 04, 2022)
2-136114917-A-C		Warts, hypogammaglobulinemia, infections, and myelokathexis	Uncertain significance (Feb 01, 2023)
2-136114920-T-C		Warts, hypogammaglobulinemia, infections, and myelokathexis	Likely benign (Jul 06, 2022)
2-136114922-C-A		Warts, hypogammaglobulinemia, infections, and myelokathexis	Pathogenic (Nov 25, 2021)
2-136114925-C-T		Warts, hypogammaglobulinemia, infections, and myelokathexis • not specified	Conflicting classifications of pathogenicity (Dec 17, 2023)
2-136114927-C-G		Warts, hypogammaglobulinemia, infections, and myelokathexis	Uncertain significance (Jan 20, 2024)
2-136114928-G-A		Warts, hypogammaglobulinemia, infections, and myelokathexis • WHIM syndrome 1	Pathogenic (Nov 07, 2023)
2-136114928-G-C		Warts, hypogammaglobulinemia, infections, and myelokathexis	Uncertain significance (Apr 27, 2021)
2-136114934-C-A		Warts, hypogammaglobulinemia, infections, and myelokathexis	Pathogenic (Aug 30, 2022)
2-136114938-GGA-G			Pathogenic (May 21, 2019)
2-136114944-G-A		not specified	Likely benign (Apr 15, 2019)
2-136114944-G-T		Warts, hypogammaglobulinemia, infections, and myelokathexis	Likely benign (Apr 18, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
CXCR4	protein_coding	protein_coding	ENST00000409817	1	3817

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0178	0.901	0	0	0	0	0.00

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.66	123	187	0.658	0.0000104	2335
Missense in Polyphen		40	87.362	0.45786		1126
Synonymous	1.49	62	78.9	0.786	0.00000467	725
Loss of Function	1.48	4	8.69	0.460	4.65e-7	117

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00	0.00
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Receptor for the C-X-C chemokine CXCL12/SDF-1 that transduces a signal by increasing intracellular calcium ion levels and enhancing MAPK1/MAPK3 activation (PubMed:10452968, PubMed:28978524, PubMed:18799424). Plays a role in regulation of cell migration, e.g. during wound healing (PubMed:28978524). Acts as a receptor for extracellular ubiquitin; leading to enhanced intracellular calcium ions and reduced cellular cAMP levels (PubMed:20228059). Binds bacterial lipopolysaccharide (LPS) et mediates LPS-induced inflammatory response, including TNF secretion by monocytes (PubMed:11276205). Involved in hematopoiesis and in cardiac ventricular septum formation. Also plays an essential role in vascularization of the gastrointestinal tract, probably by regulating vascular branching and/or remodeling processes in endothelial cells. Involved in cerebellar development. In the CNS, could mediate hippocampal-neuron survival (By similarity). {ECO:0000250|UniProtKB:P70658, ECO:0000269|PubMed:10074102, ECO:0000269|PubMed:10452968, ECO:0000269|PubMed:10644702, ECO:0000269|PubMed:10825158, ECO:0000269|PubMed:11276205, ECO:0000269|PubMed:17197449, ECO:0000269|PubMed:18799424, ECO:0000269|PubMed:20048153, ECO:0000269|PubMed:20228059, ECO:0000269|PubMed:20505072, ECO:0000269|PubMed:28978524, ECO:0000269|PubMed:8752280, ECO:0000269|PubMed:8752281}.
• Disease: DISEASE: WHIM syndrome (WHIMS) [MIM:193670]: Immunodeficiency disease characterized by neutropenia, hypogammaglobulinemia and extensive human papillomavirus (HPV) infection. Despite the peripheral neutropenia, bone marrow aspirates from affected individuals contain abundant mature myeloid cells, a condition termed myelokathexis. {ECO:0000269|PubMed:12692554}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Endocytosis - Homo sapiens (human);Chemokine signaling pathway - Homo sapiens (human);Axon guidance - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);Intestinal immune network for IgA production - Homo sapiens (human);Leukocyte transendothelial migration - Homo sapiens (human);Peptide GPCRs;Cardiac Progenitor Differentiation;Hematopoietic Stem Cell Differentiation;Amplification and Expansion of Oncogenic Pathways as Metastatic Traits;Chemokine signaling pathway;GPCRs, Class A Rhodopsin-like;Developmental Biology;Signaling by GPCR;Disease;Signal Transduction;pertussis toxin-insensitive ccr5 signaling in macrophage;hiv-1 defeats host-mediated resistance by cem15;cxcr4 signaling pathway;ion channels and their functional role in vascular endothelium;activation of csk by camp-dependent protein kinase inhibits signaling through the t cell receptor;chrebp regulation by carbohydrates and camp;role of -arrestins in the activation and targeting of map kinases;activation of camp-dependent protein kinase pka;HIV Life Cycle;HIV Infection;Infectious disease;Binding and entry of HIV virion;Chemokine receptors bind chemokines;Peptide ligand-binding receptors;Class A/1 (Rhodopsin-like receptors);roles of arrestin dependent recruitment of src kinases in gpcr signaling;GPCR ligand binding;CXCR4-mediated signaling events;-arrestins in gpcr desensitization;Signaling by ROBO receptors;IL4;G alpha (i) signalling events;Axon guidance;GPCR downstream signalling;S1P3 pathway;HIF-1-alpha transcription factor network;Syndecan-4-mediated signaling events;Early Phase of HIV Life Cycle (Consensus)

Recessive Scores

• pRec: 0.792

Intolerance Scores

• loftool: 0.329
• rvis_EVS: -0.3
• rvis_percentile_EVS: 32.62

Haploinsufficiency Scores

• pHI: 0.903
• hipred: Y
• hipred_score: 0.751
• ghis: 0.562

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.714

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Cxcr4
• Phenotype: craniofacial phenotype; muscle phenotype; cellular phenotype; homeostasis/metabolism phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); endocrine/exocrine gland phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); reproductive system phenotype; growth/size/body region phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); digestive/alimentary phenotype; skeleton phenotype; renal/urinary system phenotype; immune system phenotype; respiratory system phenotype; neoplasm

Zebrafish Information Network

• Gene name: cxcr4a
• Affected structure: endodermal cell
• Phenotype tag: abnormal
• Phenotype quality: mislocalised anteriorly

Gene ontology

• Biological process: activation of MAPK activity;response to hypoxia;dendritic cell chemotaxis;apoptotic process;chemotaxis;inflammatory response;immune response;G protein-coupled receptor signaling pathway;positive regulation of cytosolic calcium ion concentration;axon guidance;brain development;response to virus;fusion of virus membrane with host plasma membrane;calcium-mediated signaling;neurogenesis;entry into host cell;CXCL12-activated CXCR4 signaling pathway;myelin maintenance;positive regulation of oligodendrocyte differentiation;regulation of chemotaxis;cell chemotaxis;cellular response to cytokine stimulus;positive regulation of cold-induced thermogenesis
• Cellular component: cytoplasm;lysosome;early endosome;late endosome;plasma membrane;external side of plasma membrane;cell surface;integral component of membrane;cell junction;cell leading edge;cytoplasmic vesicle;protein-containing complex;extracellular exosome
• Molecular function: virus receptor activity;actin binding;G protein-coupled receptor activity;protein binding;coreceptor activity;C-C chemokine receptor activity;C-X-C chemokine receptor activity;chemokine binding;C-C chemokine binding;ubiquitin protein ligase binding;myosin light chain binding;C-X-C motif chemokine 12 receptor activity;ubiquitin binding