DGAT1

diacylglycerol O-acyltransferase 1, the group of MicroRNA protein coding host genes

Basic information

Region (hg38): 8:144314584-144326910

Previous symbols: [ "DGAT" ]

Links

ENSG00000185000 ∙ NCBI:8694 ∙ OMIM:604900 ∙ HGNC:2843 ∙ Uniprot:O75907 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• congenital diarrhea 7 with exudative enteropathy (Strong), mode of inheritance: AR
• congenital diarrhea 7 with exudative enteropathy (Moderate), mode of inheritance: AR
• congenital diarrhea 7 with exudative enteropathy (Supportive), mode of inheritance: AR
• congenital diarrhea 7 with exudative enteropathy (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Diarrhea 7, protein-losing enteropathy type	AR	Gastrointestinal	Individuals may present in infancy with severe diarrhea, protein-losing enteropathy, metabolic acidosis, and electrolyte disturbances, and preventive measures and early treatment (including TPN) may be beneficial	Gastrointestinal	23114594

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the DGAT1 gene.

• not provided (27 variants)
• Congenital diarrhea 7 with exudative enteropathy (7 variants)
• Inborn genetic diseases (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the DGAT1 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	169	8	179
missense		2	134	3	2	141
nonsense	9	1	1			11
start loss						0
frameshift	18	2	1			21
inframe indel			5			5
splice donor/acceptor (+/-2bp)	2	18	1			21
splice region			13	63	3	79
non coding			4	173	10	187
Total	29	23	148	345	20

Highest pathogenic variant AF is 0.000131

Variants in DGAT1

This is a list of pathogenic ClinVar variants found in the DGAT1 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
8-144316212-CCACACAGCTCTGGCACTCGCCCTTGTGGGTGTGGCCATACCCCCCACCAGGCCCCAGGCCCCTGGCAGGCTGAAGAGGTCACTGGACAGCACTTTATTGACACCCTCGGACCCGGGGCAGGGTCAGCAAGACTCCCAGCTGGCATCAGACTGTGTCTGGCCTGCTGTCGCCATCCCTGAGGGGTGCAGGACAGAGCCCCATAGGGGCAGAGAGGCCTCCCTGGGACCAGAGGAGGATGCTGTGCAGCCAGGCCCATCCCCAGCACTCGAGGCCTAGGAGGAGAGGTGGGCTCTGGCAGCGGGTGTGAGGTGGCAGTGAGAAGCCAGGCCCTCAGGTGCAGCTCAGGCCTCTGCCGCTGGGGCCTCATAGTTGAGCACGTAGTAGTCGTGGACGTACATGAGGACGGCTATTGGCTGTCCGATGATGAGCGACAGCCACACAGCTGCGTTGCCATAGTTGCCCTGGAAAAAGCGGCCCACGAACCAGGCCAGTGGGATCTAGGGAGTGAGGGGCCAAGTCAGTCGGCCATGGTGACCACAGGGCTGGGGGCTTCAGGGTCCCTGGGCATGGGGAGGGTCAGCCGAGGGGTTCAGGTGCGGGGTAACTGGGCGAGTGAGGAGGCCACGTGGGGGTCACTCACCTGAGCCATCATGCCCGTGAACGCCCAGAGGCGGAACATTCGCAGAGGGACGCTCACCAGGTACTGAGATGGGAGGGAGAGAGGATGCCAGGGAGTGGGGTGTCAGCCGTCCCTGCTGTGGGCATACCCCTGCCCAGGGATGAGGCAAGATGCCCCCCAGAGCACTGACCTCGTGGAAGAAGGCCGAGGCCAGGAACACCCCTGTCCTGGCCATCCACTTGCTGCTGCCCCGTCGAAGCATGGGCTTGTAGAAGTGTCTGCAGAGGAGGGGGCATGGAAAGCGGTTCAGGTTCACAGCCATGTTCCACATCACACACACACACACCCCACCTACCTGATGCACCACTTGTGCACAGGGATGTTCCAGTTCTGCCAGAAGTAGGTGACAGACTCGGAGTTCCTGGGGGCCAAGAGACCACAGGGGGATCAGAGCACACCATGGCCCATCCCAGCCCCCAGGGACACCCCAGGGACACTCACCACCAGTCCCGGTAGAACTCCCGGTCTCCAAACTGCATGAGCTCAGCCACGGCATTCAGGCAGGAGTGGAAGAGCCAGTAGAAGAAGATGAGCCAGATGAGGTGATTGGGGACCTGGCAGGGAGGTGGGGGTGGGCACCAAGTTCTAGAACCTTCCCCCACATGCCACTGTCCCCTCCTGTCCTGTGCATGCGCCACCTGTCCGCACTCACCGCCAGCTTCAGGAGGCGCTCGATGATGCGTGAGTAGTCCATGTCCTGCAGAAACAAGCCCTTCAGCTAGCCATGCTCCTGGTCACTCCCCAGCCACCCCAGCTGCAAGAGCACCTGAGCCACTCACCTTGAAGGGCTTCATGGAGTTCTGGATGGTGGGGACCATCCACTGCAAAGGAGGGCACCACGTCAGCTCCCAGCCATGCCCAGCTACACCCAACCCTGCCCTACCCCACTTACCTGCTGGATCAGCCCCACCTGGAGCTGGGTGAAGAACAGCTGGGGGGGAAACAGAGAGCAGCCAGCTGAGGCCCTGGCTAGCCAGAAGGCCCCCTAGCCTCCAGTGGCTGCCCCCAGCCCCCAACCTCACCATCTCAAGGATCCGTCGCAGCAGAAAGCGCTTCCGGATGCGGGGAGAGCG-C		Congenital diarrhea 7 with exudative enteropathy	Pathogenic (-)
8-144316557-G-A			Likely benign (Nov 18, 2023)
8-144316558-GC-G		Congenital diarrhea 7 with exudative enteropathy	Likely pathogenic (Feb 03, 2021)
8-144316559-C-T			Uncertain significance (Aug 15, 2022)
8-144316562-C-T			Uncertain significance (Oct 12, 2021)
8-144316566-C-A			Likely benign (Jan 07, 2024)
8-144316566-C-T			Likely benign (Jul 16, 2023)
8-144316567-G-A		not specified	Benign (Jan 30, 2024)
8-144316568-CTGG-C			Uncertain significance (Aug 23, 2022)
8-144316572-G-T			Likely benign (Jan 25, 2024)
8-144316578-A-G			Likely benign (Sep 10, 2023)
8-144316590-G-A			Likely benign (Nov 07, 2023)
8-144316594-T-G		Inborn genetic diseases	Uncertain significance (Oct 04, 2022)
8-144316596-G-A			Likely benign (Oct 03, 2023)
8-144316599-G-A			Benign (Dec 14, 2023)
8-144316602-G-A			Likely benign (May 30, 2023)
8-144316604-C-T			Uncertain significance (Aug 31, 2021)
8-144316605-G-A			Likely benign (Oct 26, 2023)
8-144316609-A-G			Uncertain significance (Aug 19, 2022)
8-144316614-G-A		DGAT1-related disorder	Benign/Likely benign (Jan 31, 2024)
8-144316616-C-T			Uncertain significance (Sep 17, 2021)
8-144316617-G-A			Likely benign (Dec 27, 2023)
8-144316620-T-A			Benign (Jan 31, 2024)
8-144316632-G-A			Likely benign (Jan 04, 2024)
8-144316635-G-A			Likely benign (Aug 17, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
DGAT1	protein_coding	protein_coding	ENST00000332324	17	10620

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
1.41e-17	0.0216	125663	0	78	125741	0.000310

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.04	229	278	0.824	0.0000183	3131
Missense in Polyphen		88	108.86	0.80838		1175
Synonymous	-1.11	128	113	1.13	0.00000768	963
Loss of Function	0.581	28	31.5	0.888	0.00000159	325

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000242	0.000239
Ashkenazi Jewish	0.00	0.00
East Asian	0.000218	0.000217
Finnish	0.000559	0.000554
European (Non-Finnish)	0.000366	0.000360
Middle Eastern	0.000218	0.000217
South Asian	0.000429	0.000425
Other	0.000331	0.000326

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Catalyzes the terminal and only committed step in triacylglycerol synthesis by using diacylglycerol and fatty acyl CoA as substrates. In contrast to DGAT2 it is not essential for survival. May be involved in VLDL (very low density lipoprotein) assembly. In liver, plays a role in esterifying exogenous fatty acids to glycerol. Functions as the major acyl-CoA retinol acyltransferase (ARAT) in the skin, where it acts to maintain retinoid homeostasis and prevent retinoid toxicity leading to skin and hair disorders. {ECO:0000269|PubMed:16214399, ECO:0000269|PubMed:9756920}.
• Disease: DISEASE: Diarrhea 7 (DIAR7) [MIM:615863]: A life-threatening disease characterized by severe, intractable, watery diarrhea. {ECO:0000269|PubMed:23114594}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Retinol metabolism - Homo sapiens (human);Glycerolipid metabolism - Homo sapiens (human);Fat digestion and absorption - Homo sapiens (human);Statin Pathway, Pharmacodynamics;Vitamin A Deficiency;Retinol Metabolism;Triacylglyceride Synthesis;Statin Pathway;Vitamin A and Carotenoid Metabolism;Neutrophil degranulation;Metabolism of lipids;Acyl chain remodeling of DAG and TAG;Innate Immune System;Immune System;Metabolism;Glycerophospholipid metabolism;Triglyceride biosynthesis;Triglyceride metabolism;triacylglycerol biosynthesis;Glycerophospholipid biosynthesis;Phospholipid metabolism (Consensus)

Recessive Scores

• pRec: 0.342

Intolerance Scores

• loftool: 0.812
• rvis_EVS: -0.84
• rvis_percentile_EVS: 11.36

Haploinsufficiency Scores

• pHI: 0.213
• hipred: N
• hipred_score: 0.230
• ghis: 0.470

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.914

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Dgat1
• Phenotype: cellular phenotype; homeostasis/metabolism phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype; endocrine/exocrine gland phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); digestive/alimentary phenotype; reproductive system phenotype

Gene ontology

• Biological process: triglyceride metabolic process;triglyceride biosynthetic process;lipid storage;very-low-density lipoprotein particle assembly;long-chain fatty-acyl-CoA metabolic process;acylglycerol acyl-chain remodeling;retinol metabolic process;neutrophil degranulation;diacylglycerol metabolic process;fatty acid homeostasis
• Cellular component: endoplasmic reticulum membrane;plasma membrane;integral component of membrane;specific granule membrane
• Molecular function: 2-acylglycerol O-acyltransferase activity;diacylglycerol O-acyltransferase activity;protein binding;transferase activity, transferring acyl groups;retinol O-fatty-acyltransferase activity