DIP2B

disco interacting protein 2 homolog B

Basic information

Region (hg38): 12:50504985-50748657

Links

ENSG00000066084 ∙ NCBI:57609 ∙ OMIM:611379 ∙ HGNC:29284 ∙ Uniprot:Q9P265 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• intellectual disability, FRA12A type (No Known Disease Relationship), mode of inheritance: Unknown
• intellectual disability, FRA12A type (Limited), mode of inheritance: AD
• intellectual disability, FRA12A type (Limited), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Intellectual developmental disorder, autosomal dominant, FRA12A type	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Neurologic	4042396; 10955484; 17236128

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the DIP2B gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the DIP2B gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				8	8	16
missense			72	7	3	82
nonsense			3			3
start loss			1			1
frameshift			4			4
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region				1		1
non coding		1		1	2	4
Total	0	1	80	16	13

Variants in DIP2B

This is a list of pathogenic ClinVar variants found in the DIP2B region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
12-50505023-GGTGCTGGTGGTGCTCGGCGGCCGGAGCCGGATCCTGTAGCCGGGTGTGGGCCCGTGTCTGTCCGTCCCTCCTTCGGCCCCCTCTCTTGTCTTCCGGAGTGTGGCTGGCGGAGCTGGGATGGCGGAACGAGGCCTGGAGCCGTCGCCGGCC-G			Uncertain significance (Aug 01, 2023)
12-50505151-G-C		not specified	Uncertain significance (Feb 01, 2023)
12-50505166-C-T		Intellectual disability, FRA12A type	Uncertain significance (Jan 17, 2022)
12-50505173-C-G			Likely benign (Jan 01, 2023)
12-50505181-C-T		not specified	Uncertain significance (Jan 04, 2022)
12-50505190-C-T		not specified	Uncertain significance (Jul 17, 2023)
12-50626019-C-T			Benign (Jan 24, 2018)
12-50626036-C-T		not specified	Uncertain significance (Nov 17, 2023)
12-50640769-C-T		not specified	Uncertain significance (Dec 19, 2023)
12-50640790-C-A		not specified	Uncertain significance (Jun 05, 2023)
12-50640803-G-T		not specified	Uncertain significance (Oct 29, 2024)
12-50640810-C-T			Uncertain significance (Mar 01, 2024)
12-50640841-G-A		not specified	Uncertain significance (Jan 17, 2024)
12-50660205-G-C		not specified	Uncertain significance (Nov 10, 2024)
12-50660247-A-G		not specified	Uncertain significance (Sep 03, 2024)
12-50671224-C-T		not specified	Uncertain significance (Jun 26, 2024)
12-50671258-G-T			Uncertain significance (Feb 01, 2021)
12-50671268-T-G		not specified	Uncertain significance (Sep 22, 2022)
12-50671273-A-C		DIP2B-related disorder	Uncertain significance (Aug 18, 2022)
12-50674518-T-A		Intellectual disability, FRA12A type	Uncertain significance (Oct 22, 2018)
12-50674525-C-G		not specified	Uncertain significance (Jan 28, 2023)
12-50674545-G-A		Intellectual disability, FRA12A type	Uncertain significance (Jan 14, 2022)
12-50674548-A-G		not specified	Uncertain significance (Dec 26, 2023)
12-50674556-C-A		not specified	Uncertain significance (Jun 21, 2023)
12-50674561-C-A		not specified	Uncertain significance (Nov 20, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
DIP2B	protein_coding	protein_coding	ENST00000301180	38	243683

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.999	0.000763	125715	0	33	125748	0.000131

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.18	631	899	0.702	0.0000498	10122
Missense in Polyphen		205	368.9	0.55571		4195
Synonymous	0.477	331	342	0.967	0.0000199	3282
Loss of Function	7.30	16	91.3	0.175	0.00000513	1005

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000145	0.000145
Ashkenazi Jewish	0.00	0.00
East Asian	0.0000544	0.0000544
Finnish	0.0000924	0.0000924
European (Non-Finnish)	0.000158	0.000158
Middle Eastern	0.0000544	0.0000544
South Asian	0.000197	0.000196
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

Recessive Scores

• pRec: 0.0984

Intolerance Scores

• loftool: 0.534
• rvis_EVS: -1.81
• rvis_percentile_EVS: 2.19

Haploinsufficiency Scores

• pHI: 0.305
• hipred: Y
• hipred_score: 0.639
• ghis: 0.596

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.944

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Dip2b
• Phenotype: hematopoietic system phenotype; immune system phenotype; homeostasis/metabolism phenotype

Gene ontology

• Biological process: biological_process
• Cellular component: nucleus;cytoplasm;membrane;extracellular exosome
• Molecular function: molecular_function;catalytic activity