DNAH11
dynein axonemal heavy chain 11, the group of Dyneins, axonemal outer arm complex subunits
Basic information
Region (hg38): 7:21543038-21901839
Links
Phenotypes
GenCC
Source:
- primary ciliary dyskinesia 7 (Strong), mode of inheritance: AR
- primary ciliary dyskinesia 7 (Strong), mode of inheritance: AR
- primary ciliary dyskinesia (Supportive), mode of inheritance: AD
- primary ciliary dyskinesia 7 (Definitive), mode of inheritance: AR
- primary ciliary dyskinesia 7 (Definitive), mode of inheritance: AR
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Ciliary dyskinesia, primary, 7 | AR | Allergy/Immunology/Infectious; Audiologic/Otolaryngologic; Cardiovascular; Pulmonary | Pulmonary and audiologic surveillance may be beneficial to assess respiratory and hearing function and institute early management measures; In order to facilitate mucus clearance, aggressive interventions (eg, chest percussion and oscillatory vest), as well as vaccinations and early and aggressive treatment of respiratory infections may be beneficial, though measures including lobectomy or lung transplantation may be necessary; Individuals may require surgery or other interventions related to congenital cardiac malformations | Allergy/Immunology/Infectious; Audiologic/Otolaryngologic; Cardiovascular; Gastrointestinal; Pulmonary | 9585585; 12142464; 18022865; 20301301; 20513915; 22184204; 22499950 |
| The condition can involve multiple anomalies, and individuals may require surgery or other interventions related to findings such as congenital cardiac malformations |
ClinVar
This is a list of variants' phenotypes submitted to
- Primary ciliary dyskinesia (3209 variants)
- not provided (721 variants)
- Primary ciliary dyskinesia 7 (322 variants)
- not specified (234 variants)
- Inborn genetic diseases (205 variants)
- DNAH11-related condition (18 variants)
- DNAH11-related disorder (1 variants)
- 7 conditions (1 variants)
- Male infertility (1 variants)
- Primary ciliary dyskinesia 3 (1 variants)
- Infertility disorder (1 variants)
- See cases (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the DNAH11 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 18 | 634 | 80 | 732 | ||
| missense | 13 | 757 | 306 | 275 | 1359 | |
| nonsense | 121 | 10 | 134 | |||
| start loss | 2 | |||||
| frameshift | 85 | 11 | 97 | |||
| inframe indel | 19 | 22 | ||||
| splice donor/acceptor (+/-2bp) | 27 | 43 | 74 | |||
| splice region ? | 1 | 4 | 58 | 103 | 9 | 175 |
| non coding ? | 30 | 472 | 311 | 813 | ||
| Total | 241 | 81 | 830 | 1412 | 669 |
Highest pathogenic variant AF is 0.000118
Variants in DNAH11
This is a list of pathogenic ClinVar variants found in the DNAH11 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 7-21543087-CGCGGCTGCTAAGTAGCAGCAGGTGGGAGACTAGGGTCTGCGCTCGCGGCGACCGCGGAGGAGGGTGGGCGCCTGCGGAGGTGTCCTCGCTCACTTCGGGGGGCCCAGAGTCTCGGGTGAGGAGCCAGCCGGCCTCGCGTTCCCTCGGACGGTTGCCCAATGGCAGCCCAGGTGGCAGCCCGGGAGGCGCGAGACTTCAGAGAAGCCCCGACCCTTCGCCTAACCTCGGGGGCCGGCCTGGAGGCAGTGGGCGCTGTGGAGCTCGAGGAGGAGGAGGAGAACGAGGAGGAGGCGGCGGCCAGGAGAGCGCGGAGTTTCGCCCAAGACGCGCGGGTGCGCTTCCTCGGCGGCCGCCTGGCGATGATGCTGGGGTTCACGGAGGAGAAATGGAGCCAGTATTTGGAAAGCGAGGACAACCGGCAGGTTCTTGGGGAGTTTCTGGAAAGCACCAGCCCGGCTTGCCTTGTGTTTAGCTTCGCCGCCTCGGGGCGCCTTGCGGCTTCCC-GGCGCCCCG | Primary ciliary dyskinesia | Pathogenic (Apr 11, 2023) | ||
| 7-21543110-T-G | Benign (Jan 29, 2021) | |||
| 7-21543127-C-T | Likely benign (Jun 09, 2019) | |||
| 7-21543219-C-A | Primary ciliary dyskinesia | Conflicting classifications of pathogenicity (Aug 10, 2019) | ||
| 7-21543232-C-T | not specified | Likely benign (-) | ||
| 7-21543246-A-C | Primary ciliary dyskinesia | Likely pathogenic (Dec 31, 2022) | ||
| 7-21543246-A-G | Primary ciliary dyskinesia • Primary ciliary dyskinesia 7 | Likely pathogenic (Nov 13, 2023) | ||
| 7-21543247-T-G | Primary ciliary dyskinesia | Likely pathogenic (Oct 18, 2023) | ||
| 7-21543246-A-ATGGCAGCCCAGG | Primary ciliary dyskinesia | Uncertain significance (Mar 31, 2016) | ||
| 7-21543252-GC-G | Primary ciliary dyskinesia | Pathogenic (Apr 02, 2023) | ||
| 7-21543253-C-A | Primary ciliary dyskinesia | Likely benign (Jan 13, 2024) | ||
| 7-21543253-C-T | Primary ciliary dyskinesia | Likely benign (Jan 18, 2024) | ||
| 7-21543254-C-G | Primary ciliary dyskinesia | Likely benign (Dec 03, 2023) | ||
| 7-21543264-G-A | Primary ciliary dyskinesia | Benign (Jan 25, 2024) | ||
| 7-21543266-C-T | Primary ciliary dyskinesia | Benign (Jan 19, 2024) | ||
| 7-21543268-G-T | Primary ciliary dyskinesia | Benign (Dec 21, 2023) | ||
| 7-21543269-G-C | Primary ciliary dyskinesia | Likely benign (Sep 06, 2023) | ||
| 7-21543270-G-T | Primary ciliary dyskinesia | Pathogenic (Apr 22, 2023) | ||
| 7-21543276-C-G | Primary ciliary dyskinesia | Likely benign (Nov 14, 2023) | ||
| 7-21543277-G-A | Primary ciliary dyskinesia | Likely benign (Sep 28, 2023) | ||
| 7-21543277-G-C | Primary ciliary dyskinesia | Benign (Jan 04, 2024) | ||
| 7-21543281-C-G | Primary ciliary dyskinesia | Benign (Oct 04, 2023) | ||
| 7-21543284-C-T | Primary ciliary dyskinesia | Likely benign (Feb 11, 2023) | ||
| 7-21543289-A-T | Primary ciliary dyskinesia | Likely benign (Feb 06, 2022) | ||
| 7-21543292-C-T | Primary ciliary dyskinesia | Benign (Nov 28, 2023) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| DNAH11 | protein_coding | protein_coding | ENST00000328843 | 83 | 358625 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 2.54e-58 | 1.00 | 124943 | 0 | 458 | 125401 | 0.00183 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | -5.61 | 3027 | 2.27e+3 | 1.33 | 0.000121 | 29671 |
| Missense in Polyphen | 964 | 760.18 | 1.2681 | 10331 | ||
| Synonymous | -6.34 | 1080 | 845 | 1.28 | 0.0000479 | 8350 |
| Loss of Function | 5.79 | 131 | 225 | 0.583 | 0.0000125 | 2792 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.00286 | 0.00280 |
| Ashkenazi Jewish | 0.00370 | 0.00368 |
| East Asian | 0.00288 | 0.00278 |
| Finnish | 0.00127 | 0.00125 |
| European (Non-Finnish) | 0.00179 | 0.00175 |
| Middle Eastern | 0.00288 | 0.00278 |
| South Asian | 0.00200 | 0.00186 |
| Other | 0.00252 | 0.00246 |
dbNSFP
Source:
- Function
- FUNCTION: Force generating protein of respiratory cilia. Produces force towards the minus ends of microtubules. Dynein has ATPase activity; the force-producing power stroke is thought to occur on release of ADP.;
- Disease
- DISEASE: Ciliary dyskinesia, primary, 7 (CILD7) [MIM:611884]: A disorder characterized by abnormalities of motile cilia. Respiratory infections leading to chronic inflammation and bronchiectasis are recurrent, due to defects in the respiratory cilia; reduced fertility is often observed in male patients due to abnormalities of sperm tails. Half of the patients exhibit randomization of left-right body asymmetry and situs inversus, due to dysfunction of monocilia at the embryonic node. Primary ciliary dyskinesia associated with situs inversus is referred to as Kartagener syndrome. {ECO:0000269|PubMed:12142464, ECO:0000269|PubMed:18022865, ECO:0000269|PubMed:25186273}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- Huntington,s disease - Homo sapiens (human)
(Consensus)
Recessive Scores
- pRec
- 0.122
Haploinsufficiency Scores
- pHI
- 0.125
- hipred
- hipred_score
- ghis
Essentials
- essential_gene_CRISPR
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- gene_indispensability_pred
- N
- gene_indispensability_score
- 0.130
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | High | High | High |
| Primary Immunodeficiency | High | High | High |
| Cancer | High | High | High |
Mouse Genome Informatics
- Gene name
- Dnah11
- Phenotype
- growth/size/body region phenotype; craniofacial phenotype; muscle phenotype; cellular phenotype; homeostasis/metabolism phenotype; immune system phenotype; liver/biliary system phenotype; respiratory system phenotype; embryo phenotype; normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); reproductive system phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; vision/eye phenotype; limbs/digits/tail phenotype; digestive/alimentary phenotype; renal/urinary system phenotype; skeleton phenotype;
Gene ontology
- Biological process
- regulation of cilium beat frequency;microtubule-based movement;determination of left/right symmetry;learning or memory;flagellated sperm motility;determination of left/right asymmetry in nervous system;epithelial cilium movement involved in determination of left/right asymmetry;cardiac septum morphogenesis;determination of heart left/right asymmetry;sperm flagellum movement involved in flagellated sperm motility
- Cellular component
- microtubule;dynein complex;9+0 motile cilium;9+2 motile cilium;proximal portion of axoneme
- Molecular function
- ATP binding;ATP-dependent microtubule motor activity, minus-end-directed;dynein light chain binding;dynein intermediate chain binding;dynein light intermediate chain binding