EGF

epidermal growth factor

Basic information

Region (hg38): 4:109912882-110013766

Links

ENSG00000138798 ∙ NCBI:1950 ∙ OMIM:131530 ∙ HGNC:3229 ∙ Uniprot:P01133 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• renal hypomagnesemia 4 (Limited), mode of inheritance: AD
• familial primary hypomagnesemia with normocalciuria and normocalcemia (Supportive), mode of inheritance: AD
• renal hypomagnesemia 4 (Limited), mode of inheritance: Unknown

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Hypomagnesemia 4, renal	AR	Renal	Children may present with tetany and/or convulsions, and failure of early diagnosis (or treatment noncompliance) can be fatal or result in permanent neurological damage due to electrolyte abnormalities; Replacement therapy may be beneficial	Renal	3436090; 17671655

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the EGF gene.

• not provided (327 variants)
• Renal hypomagnesemia 4 (142 variants)
• Inborn genetic diseases (27 variants)
• not specified (5 variants)
• Renal Hypomagnesemia, Recessive (5 variants)
• EGF-related condition (2 variants)
• Hereditary renal cell carcinoma (1 variants)
• Cholangiocarcinoma (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the EGF gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			6	36	5	47
missense			107	13	11	131
nonsense			9	1		10
start loss			1			1
frameshift			2		1	3
inframe indel						0
splice donor/acceptor (+/-2bp)			2			2
splice region			7	3	1	11
non coding			39	54	103	196
Total	0	0	166	104	120

Variants in EGF

This is a list of pathogenic ClinVar variants found in the EGF region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
4-109912889-G-A		Renal hypomagnesemia 4	Likely benign (Jan 12, 2018)
4-109912912-G-A		Renal hypomagnesemia 4	Benign (Jan 13, 2018)
4-109912954-A-G		Renal hypomagnesemia 4 • Cholangiocarcinoma	Benign (Jan 31, 2024)
4-109912975-C-G		Renal hypomagnesemia 4	Uncertain significance (Jan 12, 2018)
4-109912994-C-G		Renal hypomagnesemia 4	Uncertain significance (Jan 13, 2018)
4-109912994-C-T			Likely benign (May 14, 2020)
4-109913053-G-C		Renal hypomagnesemia 4	Uncertain significance (Jan 12, 2018)
4-109913063-T-C		Renal hypomagnesemia 4	Uncertain significance (Jan 12, 2018)
4-109913066-T-G		Renal hypomagnesemia 4	Uncertain significance (Jan 15, 2018)
4-109913071-G-T		Renal hypomagnesemia 4	Uncertain significance (Jan 13, 2018)
4-109913108-G-C		Renal hypomagnesemia 4	Uncertain significance (Apr 28, 2017)
4-109913149-TTCAGAAGGTCTCTCAGTTGAAGAAAGAGCTTGGAGGACAACAGCACAACAGGAGAGTAAAAGATGCCCCAGGGCTGAGGCCTCCGCTCAGGCAGCCGCATCTGGGGTCAATCATACTCACCTTGCCCGGGCCATGCTCCAGCAAAATCAAGCTGTTTTCTTTTGAAAGTTCAAACTCATCAAGATTATGCTGCTCACTCTTATCATTCTGTTGCCAGTAGTTTCAAAATTTAGTTTTGTTAGTCTCTCAGCACCGCAGCACTGGAGCTGTCC-T			Uncertain significance (Oct 28, 2023)
4-109913196-A-G		Renal hypomagnesemia 4	Uncertain significance (Jan 12, 2018)
4-109913209-A-C		Renal hypomagnesemia 4	Uncertain significance (Jan 13, 2018)
4-109913234-G-A		Renal hypomagnesemia 4	Likely benign (Jan 12, 2018)
4-109913258-A-G		Renal hypomagnesemia 4	Likely benign (Jan 13, 2018)
4-109913276-C-T		Renal hypomagnesemia 4	Uncertain significance (Apr 27, 2017)
4-109913341-G-A			Likely benign (Jan 07, 2024)
4-109913381-A-C		Renal hypomagnesemia 4	Benign/Likely benign (Jan 20, 2024)
4-109913382-G-C		Renal hypomagnesemia 4 • Hereditary renal cell carcinoma	Uncertain significance (Jan 12, 2018)
4-109913392-T-C		Renal hypomagnesemia 4	Conflicting classifications of pathogenicity (Oct 16, 2023)
4-109913434-C-T			Likely benign (Oct 07, 2022)
4-109913435-G-A			Uncertain significance (Dec 11, 2023)
4-109913452-T-A			Likely benign (Aug 01, 2022)
4-109913471-T-C			Likely benign (Apr 20, 2022)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
EGF	protein_coding	protein_coding	ENST00000265171	24	99383

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
8.53e-17	1.00	125629	0	119	125748	0.000473

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.938	571	638	0.895	0.0000338	7919
Missense in Polyphen		129	176.13	0.73241		2235
Synonymous	-0.775	241	226	1.07	0.0000119	2277
Loss of Function	3.29	37	65.8	0.563	0.00000383	761

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00168	0.00168
Ashkenazi Jewish	0.00	0.00
East Asian	0.000708	0.000707
Finnish	0.00	0.00
European (Non-Finnish)	0.000379	0.000378
Middle Eastern	0.000708	0.000707
South Asian	0.000561	0.000555
Other	0.000815	0.000815

dbNSFP

Source: dbNSFP

• Function: FUNCTION: EGF stimulates the growth of various epidermal and epithelial tissues in vivo and in vitro and of some fibroblasts in cell culture. Magnesiotropic hormone that stimulates magnesium reabsorption in the renal distal convoluted tubule via engagement of EGFR and activation of the magnesium channel TRPM6. Can induce neurite outgrowth in motoneurons of the pond snail Lymnaea stagnalis in vitro (PubMed:10964941). {ECO:0000269|PubMed:10964941, ECO:0000269|PubMed:17671655}.
• Disease: DISEASE: Hypomagnesemia 4 (HOMG4) [MIM:611718]: A disorder characterized by massive renal hypomagnesemia and normal levels of serum calcium and calcium excretion. Clinical features include seizures, mild-to moderate psychomotor retardation, and brisk tendon reflexes. {ECO:0000269|PubMed:17671655}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: PI3K-Akt signaling pathway - Homo sapiens (human);Non-small cell lung cancer - Homo sapiens (human);Gastric cancer - Homo sapiens (human);Focal adhesion - Homo sapiens (human);Choline metabolism in cancer - Homo sapiens (human);Melanoma - Homo sapiens (human);Bladder cancer - Homo sapiens (human);HIF-1 signaling pathway - Homo sapiens (human);Jak-STAT signaling pathway - Homo sapiens (human);Breast cancer - Homo sapiens (human);ErbB signaling pathway - Homo sapiens (human);Gap junction - Homo sapiens (human);FoxO signaling pathway - Homo sapiens (human);Regulation of actin cytoskeleton - Homo sapiens (human);Glioma - Homo sapiens (human);Prostate cancer - Homo sapiens (human);Rap1 signaling pathway - Homo sapiens (human);Ras signaling pathway - Homo sapiens (human);MAPK signaling pathway - Homo sapiens (human);Phospholipase D signaling pathway - Homo sapiens (human);Pathways in cancer - Homo sapiens (human);Hepatitis C - Homo sapiens (human);Cytokine-cytokine receptor interaction - Homo sapiens (human);Pancreatic cancer - Homo sapiens (human);Endometrial cancer - Homo sapiens (human);Colorectal cancer - Homo sapiens (human);EGFR Inhibitor Pathway, Pharmacodynamics;Human papillomavirus infection - Homo sapiens (human);EGF-Core;MicroRNAs in cardiomyocyte hypertrophy;Polycystic Kidney Disease Pathway;JAK-STAT;Cardiac Hypertrophic Response;Hair Follicle Development- Induction (Part 1 of 3);Bladder Cancer;Differentiation Pathway;Focal Adhesion;Lung fibrosis;MAPK Signaling Pathway;ERK Pathway in Huntington,s Disease;ESC Pluripotency Pathways;Focal Adhesion-PI3K-Akt-mTOR-signaling pathway;Endometrial cancer;PI3K-Akt Signaling Pathway;EGF-EGFR Signaling Pathway;Regulation of Actin Cytoskeleton;TGF-beta Receptor Signaling;ErbB Signaling Pathway;SHC1 events in ERBB2 signaling;Signaling by PTK6;Disease;Signal Transduction;Vesicle-mediated transport;role of egf receptor transactivation by gpcrs in cardiac hypertrophy;egf signaling pathway;mcalpain and friends in cell motility;sprouty regulation of tyrosine kinase signals;cbl mediated ligand-induced downregulation of egf receptors pathway;Membrane Trafficking;keratinocyte differentiation;ERBB2 Activates PTK6 Signaling;map kinase inactivation of smrt corepressor;SHC1 events in EGFR signaling;GPCR signaling-G alpha q;GPCR signaling-cholera toxin;GPCR signaling-pertussis toxin;NOTCH3 Activation and Transmission of Signal to the Nucleus;EGFR interacts with phospholipase C-gamma;Signaling by NOTCH3;Signaling by NOTCH;GPCR signaling-G alpha s Epac and ERK;EGFR downregulation;Signaling by EGFR;Downregulation of ERBB2 signaling;Platelet degranulation ;Response to elevated platelet cytosolic Ca2+;Platelet activation, signaling and aggregation;GPCR signaling-G alpha s PKA and ERK;Clathrin-mediated endocytosis;EGFR1;SHP2 signaling;ErbB1 downstream signaling;Hemostasis;GAB1 signalosome;RAF/MAP kinase cascade;MAPK1/MAPK3 signaling;MAPK family signaling cascades;Signaling events mediated by TCPTP;Thromboxane A2 receptor signaling;PIP3 activates AKT signaling;GRB2 events in ERBB2 signaling;Signaling by Non-Receptor Tyrosine Kinases;Posttranslational regulation of adherens junction stability and dissassembly;a6b1 and a6b4 Integrin signaling;Cargo recognition for clathrin-mediated endocytosis;PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling;Negative regulation of the PI3K/AKT network;Signaling by EGFR in Cancer;EGFR-dependent Endothelin signaling events;GRB2 events in EGFR signaling;Constitutive Signaling by Aberrant PI3K in Cancer;PI3K events in ERBB2 signaling;PLCG1 events in ERBB2 signaling;Signaling by ERBB2;ERBB2 Regulates Cell Motility;PI3K/AKT Signaling in Cancer;GPCR signaling-G alpha i;Signaling by ERBB4;Inhibition of Signaling by Overexpressed EGFR;Signaling by Overexpressed Wild-Type EGFR in Cancer;Signaling by Receptor Tyrosine Kinases;Constitutive Signaling by Ligand-Responsive EGFR Cancer Variants;Signaling by Ligand-Responsive EGFR Variants in Cancer;EGF;Intracellular signaling by second messengers;Stabilization and expansion of the E-cadherin adherens junction;Diseases of signal transduction;Internalization of ErbB1;Regulation of Telomerase;Arf6 signaling events;Signaling events mediated by PTP1B;ErbB receptor signaling network;Ceramide signaling pathway (Consensus)

Recessive Scores

• pRec: 0.973

Intolerance Scores

• loftool: 0.0495
• rvis_EVS: 1.3
• rvis_percentile_EVS: 93.91

Haploinsufficiency Scores

• pHI: 0.396
• hipred: N
• hipred_score: 0.454
• ghis: 0.386

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.991

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Egf
• Phenotype: reproductive system phenotype; normal phenotype; immune system phenotype; vision/eye phenotype; digestive/alimentary phenotype; endocrine/exocrine gland phenotype; integument phenotype (the observable morphological and physiological characteristics of the skin and its associated structures, such as the hair, nails, sweat glands, sebaceous glands and other secretory glands that are manifested through development and lifespan); growth/size/body region phenotype

Zebrafish Information Network

• Gene name: egf
• Affected structure: dorsal longitudinal anastomotic vessel
• Phenotype tag: abnormal
• Phenotype quality: absent

Gene ontology

• Biological process: MAPK cascade;activation of MAPKK activity;activation of MAPK activity;angiogenesis;positive regulation of receptor internalization;platelet degranulation;signal transduction;activation of transmembrane receptor protein tyrosine kinase activity;epidermal growth factor receptor signaling pathway;positive regulation of cell population proliferation;positive regulation of gene expression;positive regulation of peptidyl-threonine phosphorylation;peptidyl-tyrosine phosphorylation;positive regulation of cerebellar granule cell precursor proliferation;positive regulation of cell migration;ERBB2 signaling pathway;negative regulation of epidermal growth factor receptor signaling pathway;positive regulation of phosphorylation;positive regulation of DNA binding;positive regulation of MAP kinase activity;positive regulation of epidermal growth factor-activated receptor activity;negative regulation of Notch signaling pathway;positive regulation of mitotic nuclear division;positive regulation of transcription, DNA-templated;regulation of JAK-STAT cascade;phosphatidylinositol phosphorylation;branching morphogenesis of an epithelial tube;negative regulation of secretion;positive regulation of protein kinase B signaling;canonical Wnt signaling pathway;mammary gland alveolus development;membrane organization;ERK1 and ERK2 cascade;positive regulation of canonical Wnt signaling pathway;regulation of calcium ion import;negative regulation of cholesterol efflux;positive regulation of hyaluronan biosynthetic process;negative regulation of ERBB signaling pathway;regulation of protein localization to cell surface;positive regulation of ubiquitin-dependent protein catabolic process;regulation of cell motility
• Cellular component: extracellular region;extracellular space;lysosomal membrane;plasma membrane;integral component of membrane;clathrin-coated vesicle membrane;platelet alpha granule lumen;receptor complex;extracellular exosome
• Molecular function: protein tyrosine kinase activity;Ras guanyl-nucleotide exchange factor activity;epidermal growth factor receptor binding;calcium ion binding;protein binding;growth factor activity;Wnt-protein binding;transmembrane receptor protein tyrosine kinase activator activity;Wnt-activated receptor activity;phosphatidylinositol-4,5-bisphosphate 3-kinase activity