EHMT1
euchromatic histone lysine methyltransferase 1, the group of Lysine methyltransferases|Ankyrin repeat domain containing|SET domain containing
Basic information
Region (hg38): 9:137618992-137870016
Previous symbols: [ "EHMT1-IT1" ]
Links
Phenotypes
GenCC
Source:
- Kleefstra syndrome 1 (Strong), mode of inheritance: AD
- Kleefstra syndrome 1 (Strong), mode of inheritance: AD
- Kleefstra syndrome (Definitive), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Kleefstra syndrome 1 | AD | Cardiovascular | The condition can involve congenital cardiac anomalies, and awareness may allow early management | Cardiovascular; Musculoskeletal; Neurologic | 16826528; 19264732; 21910222; 22670143; 23232695 |
ClinVar
This is a list of variants' phenotypes submitted to
- Kleefstra syndrome 1 (62 variants)
- not provided (46 variants)
- Inborn genetic diseases (8 variants)
- Intellectual disability (4 variants)
- Difficulty walking;Abnormal facial shape;Polymicrogyria;Global developmental delay (1 variants)
- Kleefstra syndrome (1 variants)
- Autism spectrum disorder;Kleefstra syndrome 1 (1 variants)
- EHMT1-related disorder (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the EHMT1 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 396 | 40 | 443 | |||
| missense | 10 | 470 | 250 | 70 | 803 | |
| nonsense | 33 | 43 | ||||
| start loss | 3 | |||||
| frameshift | 57 | 10 | 72 | |||
| inframe indel | 10 | 18 | ||||
| splice donor/acceptor (+/-2bp) | 16 | 17 | 37 | |||
| splice region | 1 | 26 | 74 | 9 | 110 | |
| non coding | 263 | 98 | 370 | |||
| Total | 109 | 52 | 504 | 916 | 208 |
Variants in EHMT1
This is a list of pathogenic ClinVar variants found in the EHMT1 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 9-137619024-G-A | Inborn genetic diseases | Uncertain significance (Feb 14, 2023) | ||
| 9-137619024-G-C | Uncertain significance (Mar 07, 2023) | |||
| 9-137619028-C-A | Uncertain significance (Nov 20, 2020) | |||
| 9-137619029-A-G | Kleefstra syndrome 1 | Likely benign (Mar 09, 2021) | ||
| 9-137619030-T-G | Kleefstra syndrome 1 | Uncertain significance (Jun 19, 2023) | ||
| 9-137619031-G-A | Kleefstra syndrome 1 | Uncertain significance (Dec 21, 2023) | ||
| 9-137619031-GGCCGCCGCCGATGCCGAGGTGAGCAGCGGGGCCGGCGGGGGGCGGCGCGGGGGCGGCGGGCAGCGGCGGAGGCGGCGCGGGGGCGAAGAACCGGGCGGGGCGGCGGCAGGCGGCCGGCGGGCGGGCGGGGCCCCGGGTCCCCCCGCCGCCGCCGCCGCCGCT-G | Kleefstra syndrome 1 | Likely pathogenic (Mar 05, 2019) | ||
| 9-137619033-C-T | Kleefstra syndrome 1 | Uncertain significance (Aug 17, 2023) | ||
| 9-137619034-C-T | Kleefstra syndrome 1 | Likely benign (Mar 20, 2023) | ||
| 9-137619035-G-A | Kleefstra syndrome 1 | Uncertain significance (Jan 15, 2024) | ||
| 9-137619037-C-A | Kleefstra syndrome 1 | Likely benign (Apr 09, 2023) | ||
| 9-137619040-C-A | Kleefstra syndrome 1 | Likely benign (Aug 23, 2023) | ||
| 9-137619040-C-G | Kleefstra syndrome 1 | Benign (Dec 12, 2023) | ||
| 9-137619041-G-A | not specified • Kleefstra syndrome 1 | Conflicting classifications of pathogenicity (Dec 01, 2023) | ||
| 9-137619041-G-T | Kleefstra syndrome 1 | Benign (Nov 03, 2023) | ||
| 9-137619042-A-G | Kleefstra syndrome 1 | Uncertain significance (Aug 10, 2023) | ||
| 9-137619044-G-C | Inborn genetic diseases | Uncertain significance (May 06, 2021) | ||
| 9-137619045-C-T | Kleefstra syndrome 1 | Uncertain significance (Jul 12, 2022) | ||
| 9-137619046-C-G | Kleefstra syndrome 1 | Likely benign (Apr 26, 2023) | ||
| 9-137619046-C-T | Kleefstra syndrome 1 | Likely benign (Jul 26, 2023) | ||
| 9-137619046-CGAGGT-C | Kleefstra syndrome 1 | Likely pathogenic (-) | ||
| 9-137619047-G-A | Kleefstra syndrome 1 | Uncertain significance (Jun 01, 2024) | ||
| 9-137619047-G-C | Uncertain significance (Mar 08, 2022) | |||
| 9-137619048-A-T | Uncertain significance (May 17, 2022) | |||
| 9-137619052-G-T | Kleefstra syndrome 1 | Uncertain significance (May 26, 2021) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| EHMT1 | protein_coding | protein_coding | ENST00000460843 | 27 | 251025 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 1.00 | 1.70e-10 | 125744 | 0 | 4 | 125748 | 0.0000159 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 1.16 | 713 | 806 | 0.885 | 0.0000565 | 8520 |
| Missense in Polyphen | 167 | 302.96 | 0.55122 | 3167 | ||
| Synonymous | -3.17 | 425 | 350 | 1.22 | 0.0000298 | 2528 |
| Loss of Function | 7.42 | 1 | 66.1 | 0.0151 | 0.00000385 | 742 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.00 | 0.00 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.0000544 | 0.0000544 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000277 | 0.0000264 |
| Middle Eastern | 0.0000544 | 0.0000544 |
| South Asian | 0.00 | 0.00 |
| Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Histone methyltransferase that specifically mono- and dimethylates 'Lys-9' of histone H3 (H3K9me1 and H3K9me2, respectively) in euchromatin. H3K9me represents a specific tag for epigenetic transcriptional repression by recruiting HP1 proteins to methylated histones. Also weakly methylates 'Lys-27' of histone H3 (H3K27me). Also required for DNA methylation, the histone methyltransferase activity is not required for DNA methylation, suggesting that these 2 activities function independently. Probably targeted to histone H3 by different DNA-binding proteins like E2F6, MGA, MAX and/or DP1. During G0 phase, it probably contributes to silencing of MYC- and E2F-responsive genes, suggesting a role in G0/G1 transition in cell cycle. In addition to the histone methyltransferase activity, also methylates non- histone proteins: mediates dimethylation of 'Lys-373' of p53/TP53. {ECO:0000269|PubMed:12004135, ECO:0000269|PubMed:20118233}.;
- Disease
- DISEASE: Kleefstra syndrome 1 (KLEFS1) [MIM:610253]: A form of Kleefstra syndrome, an autosomal dominant disease characterized by variable mental retardation, psychomotor developmental delay, seizures, behavioral abnormalities, and facial dysmorphisms. KLEFS1 patients additionally manifest brachy(micro)cephaly, congenital heart defects, and urogenital defects. {ECO:0000269|PubMed:16826528, ECO:0000269|PubMed:19264732}. Note=The disease is caused by mutations affecting the gene represented in this entry (PubMed:16826528). The syndrome can be either caused by intragenic EHMT1 mutations leading to haploinsufficiency of the EHMT1 gene or by a submicroscopic 9q34.3 deletion. Although it is not known if and to what extent other genes in the 9q34.3 region contribute to the syndrome observed in deletion cases, EHMT1 seems to be the major determinant of the core disease phenotype (PubMed:19264732). {ECO:0000269|PubMed:16826528, ECO:0000269|PubMed:19264732}.;
- Pathway
- Lysine degradation - Homo sapiens (human);Longevity regulating pathway - Homo sapiens (human);miR-targeted genes in epithelium - TarBase;miR-targeted genes in lymphocytes - TarBase;miR-targeted genes in muscle cell - TarBase;Histone Modifications;Gene expression (Transcription);Transcriptional Regulation by E2F6;Generic Transcription Pathway;Senescence-Associated Secretory Phenotype (SASP);Cellular Senescence;Cellular responses to stress;PKMTs methylate histone lysines;RNA Polymerase II Transcription;Chromatin modifying enzymes;Cellular responses to external stimuli;Lysine metabolism;Chromatin organization;Regulation of TP53 Activity through Methylation;Regulation of TP53 Activity;Transcriptional Regulation by TP53
(Consensus)
Recessive Scores
- pRec
- 0.146
Intolerance Scores
- loftool
- 0.0183
- rvis_EVS
- -1.58
- rvis_percentile_EVS
- 3.13
Haploinsufficiency Scores
- pHI
- 0.197
- hipred
- Y
- hipred_score
- 0.774
- ghis
- 0.609
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- S
- essential_gene_gene_trap
- E
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.949
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Ehmt1
- Phenotype
- homeostasis/metabolism phenotype; cellular phenotype; craniofacial phenotype; growth/size/body region phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); liver/biliary system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); immune system phenotype; skeleton phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); hematopoietic system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); normal phenotype; embryo phenotype;
Gene ontology
- Biological process
- negative regulation of transcription by RNA polymerase II;DNA methylation;chromatin organization;histone methylation;peptidyl-lysine monomethylation;peptidyl-lysine dimethylation;negative regulation of transcription, DNA-templated;regulation of embryonic development;histone H3-K9 methylation;response to fungicide;negative regulation of G0 to G1 transition;histone H3-K27 methylation;positive regulation of cold-induced thermogenesis
- Cellular component
- nucleus;nucleoplasm;chromosome;nuclear body
- Molecular function
- p53 binding;protein binding;methyltransferase activity;zinc ion binding;protein-lysine N-methyltransferase activity;histone-lysine N-methyltransferase activity;histone methyltransferase activity (H3-K9 specific);histone methyltransferase activity (H3-K27 specific);C2H2 zinc finger domain binding