FUNDC2

FUN14 domain containing 2

Basic information

Region (hg38): X:155025979-155060304

Links

ENSG00000165775 ∙ NCBI:65991 ∙ OMIM:301042 ∙ HGNC:24925 ∙ Uniprot:Q9BWH2 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

No genCC data.

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the FUNDC2 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the FUNDC2 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous						0
missense			7			7
nonsense						0
start loss						0
frameshift						0
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding						0
Total	0	0	7	0	0

Variants in FUNDC2

This is a list of pathogenic ClinVar variants found in the FUNDC2 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
X-155026934-TGGGAATGGAAACATCTGCCCCACGTGCCGGAAGCCAAGTGGTGGCGACAACTGCGCGCCACTCCGCGGCCTACCGCGCAGATCCTCTACGTGTGTCCTCGCGAGACAAGCTCACCGAAATGGCCGCGTCCAGTCAAGGTAAGGGCGGGCGCGCGCGCGGCCGGCGCCGCGGGGAGCCGCCTTCCTG-T		Hereditary factor VIII deficiency disease	Pathogenic (Jun 01, 2019)
X-155026961-C-A		not specified	Uncertain significance (Feb 09, 2022)
X-155026975-G-A		not specified	Uncertain significance (Mar 14, 2023)
X-155026993-C-T		not specified	Uncertain significance (Dec 14, 2022)
X-155027041-A-C		not specified	Uncertain significance (Mar 01, 2024)
X-155027065-A-G		not specified	Uncertain significance (Dec 07, 2021)
X-155033480-G-A		not specified	Uncertain significance (Sep 17, 2021)
X-155046571-T-G		not specified	Uncertain significance (Sep 14, 2021)
X-155051755-G-A		not specified	Uncertain significance (Jun 16, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
FUNDC2	protein_coding	protein_coding	ENST00000369498	5	34324

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0598	0.875	125727	2	2	125731	0.0000159

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.363	62	70.6	0.878	0.00000523	1209
Missense in Polyphen		8	21.121	0.37877		396
Synonymous	0.773	22	27.1	0.811	0.00000200	379
Loss of Function	1.55	3	7.61	0.394	5.64e-7	121

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000229	0.000185
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.0000122	0.00000879
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

Recessive Scores

• pRec: 0.0660

Intolerance Scores

• loftool: 0.240
• rvis_EVS: -0.03
• rvis_percentile_EVS: 51.04

Haploinsufficiency Scores

• pHI: 0.0311
• hipred: N
• hipred_score: 0.488
• ghis: 0.506

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.887

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Fundc2

Gene ontology

• Biological process: autophagy of mitochondrion
• Cellular component: nucleus;mitochondrion;integral component of mitochondrial outer membrane