GAA
Basic information
Region (hg38): 17:80101555-80119881
Links
Phenotypes
GenCC
Source:
- glycogen storage disease II (Definitive), mode of inheritance: AR
- glycogen storage disease II (Strong), mode of inheritance: AR
- glycogen storage disease II (Strong), mode of inheritance: AR
- glycogen storage disease due to acid maltase deficiency, infantile onset (Supportive), mode of inheritance: AR
- glycogen storage disease due to acid maltase deficiency, late-onset (Supportive), mode of inheritance: AR
- glycogen storage disease II (Definitive), mode of inheritance: AR
- glycogen storage disease II (Strong), mode of inheritance: AR
- glycogen storage disease II (Definitive), mode of inheritance: AR
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Glycogen storage disease II | AR | Biochemical; Cardiovascular; Pharmacogenomic | Enzyme therapy is available; Disease-specific care of cardiomyopathy may be beneficial (eg, some standard drugs are contraindicated, and there is high risk for arrhythmias and sudden cardiac death) | Biochemical; Cardiovascular; Musculoskeletal; Neurologic; Pulmonary | 5217754; 4288232; 5229488; 5247277; 5240358; 6810200; 6401355; 3084996; 3093639; 3090917; 3322184; 3135192; 3282727; 3288378; 2403755; 2243227; 2203258; 1895140; 11071489; 10931430; 11286229; 12601120; 12897283; 15668445; 15985590; 16433701; 17190962; 16917947; 19047571; 19047572; 20301438; 21543987; 21518733; 21637107; 22253258; 22334186; 22353292; 22365055; 22492103; 22538254; 22539577; 22581536; 22616199; 23884227; 24008937; 24011652; 24044919 |
ClinVar
This is a list of variants' phenotypes submitted to
- Glycogen storage disease, type II (2320 variants)
- not provided (798 variants)
- Cardiovascular phenotype (235 variants)
- not specified (191 variants)
- Inborn genetic diseases (9 variants)
- Glycogen storage disease type II, infantile (6 variants)
- Glycogen storage disease II, adult form (6 variants)
- GAA-related condition (5 variants)
- Primary ciliary dyskinesia (4 variants)
- Cardiomyopathy (3 variants)
- Primary dilated cardiomyopathy (3 variants)
- See cases (2 variants)
- Primary ciliary dyskinesia 15 (2 variants)
- Glycogen storage disease (2 variants)
- Hypertrophic cardiomyopathy (2 variants)
- Glycogen storage disease, type IV (1 variants)
- Ventricular fibrillation (1 variants)
- Glycogen storage disease due to glucose-6-phosphatase deficiency type IA (1 variants)
- Long QT syndrome (1 variants)
- Glycoprotein storage disease (1 variants)
- Acid alpha-glucosidase, allele 2 (1 variants)
- Acid alpha-glucosidase, allele 4 (1 variants)
- Abnormality of metabolism/homeostasis (1 variants)
- Glycogen storage disease due to acid maltase deficiency, late-onset (1 variants)
- Elevated circulating creatine kinase concentration (1 variants)
- Myopathy (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the GAA gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 13 | 507 | 529 | |||
missense | 59 | 120 | 694 | 889 | ||
nonsense | 73 | 24 | 98 | |||
start loss | 6 | |||||
frameshift | 117 | 79 | 197 | |||
inframe indel | 22 | 32 | ||||
splice donor/acceptor (+/-2bp) | 20 | 52 | 77 | |||
splice region ? | 3 | 9 | 61 | 90 | 2 | 165 |
non coding ? | 33 | 248 | 60 | 344 | ||
Total | 279 | 284 | 769 | 764 | 76 |
Highest pathogenic variant AF is 0.00376
Variants in GAA
This is a list of pathogenic ClinVar variants found in the GAA region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
17-80101562-C-T | Likely benign (Aug 22, 2021) | |||
17-80101585-C-G | Glycogen storage disease, type II • Primary ciliary dyskinesia | Benign/Likely benign (May 12, 2021) | ||
17-80101598-C-T | Primary ciliary dyskinesia 15 • Glycogen storage disease, type II | Uncertain significance (Jan 13, 2018) | ||
17-80101606-C-T | not specified | Likely benign (Dec 11, 2017) | ||
17-80101611-C-T | Glycogen storage disease, type II • not specified • GAA-related disorder | Conflicting classifications of pathogenicity (Feb 23, 2022) | ||
17-80101612-G-C | GAA-related disorder | Likely benign (Mar 29, 2021) | ||
17-80101639-G-A | not specified | Likely benign (May 08, 2017) | ||
17-80101663-G-C | Primary ciliary dyskinesia • Glycogen storage disease, type II | Benign/Likely benign (Jun 29, 2018) | ||
17-80101687-C-T | Glycogen storage disease, type II | Uncertain significance (Jan 13, 2018) | ||
17-80101745-G-A | Glycogen storage disease, type II • Primary ciliary dyskinesia | Benign/Likely benign (May 12, 2021) | ||
17-80101807-C-T | Glycogen storage disease, type II | Conflicting classifications of pathogenicity (May 13, 2021) | ||
17-80101819-C-T | not specified | Likely benign (Jan 26, 2017) | ||
17-80101820-G-A | Likely benign (Jun 05, 2018) | |||
17-80101848-C-G | Glycogen storage disease, type II • Primary ciliary dyskinesia 15 | Likely benign (Mar 17, 2021) | ||
17-80101861-A-C | Glycogen storage disease, type II | Uncertain significance (Jan 13, 2018) | ||
17-80101879-G-A | GAA-related disorder | Likely benign (Jan 09, 2022) | ||
17-80101886-A-G | not specified | Likely benign (Oct 07, 2016) | ||
17-80101907-C-T | not specified | Likely benign (Mar 01, 2017) | ||
17-80102109-G-C | Benign (Jul 03, 2018) | |||
17-80104166-AAGTGGGAGGATTGCTTGAGTCTGGGAGGTGGAGGTTGCAGTGAGCCAGGATCTCACCACAGCACTCTGGCCCAGGCGACAGCTGTTTGGCCTGTTTCAAGTGTCTACCTGCCTTGCTGGTCTTCCTGGGGACATTCTAAGCGTGTTTGATTTGTAACATTTTAGCAGACTGTGCAAGTGCTCTGCACTCCCCTGCTGGAGCTTTTCTCGCCCTTCCTTCTGGCCCTCTCCCCAGTCTAGACAGCAGGGCAACACCCACCCTGGCCACCTTACCCCACCTGCCTGGGTGCTGCAGTGCCAGCCGCGGTTGATGTCTCAGAGCTGCTTTGAGAGCCCCGTGAGTGCCGCCCCTCCCGCCTCCCTGCTGAGCCCGCTTTCTTCTCCCGCAGGCCTGTAGGAGCTGTCCAGGCCATCTCCAACCATGGGAGTGAGGCACCCGCCCTGCTCCCACCGGCTCCTGGCCGTCTGCGCCCTCGTGTCCTTGGCAACCGCTGCACTCCTGGGGCACATCCTACTCCATGATTTCCTGCTGGTTCCCCGAGAGCTGAGTGGCTCCTCCCC-A | Glycogen storage disease, type II | Pathogenic (Jul 19, 2023) | ||
17-80104374-C-T | Likely benign (Jun 16, 2018) | |||
17-80104471-G-A | Likely benign (Jul 14, 2018) | |||
17-80104537-C-G | Glycogen storage disease type II, infantile | Uncertain significance (Feb 19, 2019) | ||
17-80104538-G-A | GAA-related disorder | Likely benign (Jan 22, 2020) | ||
17-80104538-GCTTTCTT-TCCCTGCTGAGCCTCCTACAGGCCTCCCGC | Glycogen storage disease, type II | Likely pathogenic (Oct 06, 2022) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
GAA | protein_coding | protein_coding | ENST00000302262 | 19 | 18324 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
2.82e-18 | 0.360 | 125568 | 0 | 178 | 125746 | 0.000708 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | -0.633 | 646 | 602 | 1.07 | 0.0000408 | 6128 |
Missense in Polyphen | 214 | 204.02 | 1.0489 | 2086 | ||
Synonymous | -0.901 | 290 | 271 | 1.07 | 0.0000207 | 1986 |
Loss of Function | 1.66 | 34 | 46.1 | 0.737 | 0.00000236 | 447 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00339 | 0.00335 |
Ashkenazi Jewish | 0.000101 | 0.0000992 |
East Asian | 0.000764 | 0.000761 |
Finnish | 0.000375 | 0.000370 |
European (Non-Finnish) | 0.000705 | 0.000668 |
Middle Eastern | 0.000764 | 0.000761 |
South Asian | 0.000401 | 0.000392 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: Essential for the degradation of glycogen in lysosomes (PubMed:1856189, PubMed:7717400, PubMed:14695532, PubMed:18429042). Has highest activity on alpha-1,4-linked glycosidic linkages, but can also hydrolyze alpha-1,6-linked glucans (PubMed:29061980). {ECO:0000269|PubMed:14695532, ECO:0000269|PubMed:18429042, ECO:0000269|PubMed:1856189, ECO:0000269|PubMed:29061980, ECO:0000269|PubMed:7717400}.;
- Disease
- DISEASE: Glycogen storage disease 2 (GSD2) [MIM:232300]: A metabolic disorder with a broad clinical spectrum. The severe infantile form, or Pompe disease, presents at birth with massive accumulation of glycogen in muscle, heart and liver. Cardiomyopathy and muscular hypotonia are the cardinal features of this form whose life expectancy is less than two years. The juvenile and adult forms present as limb-girdle muscular dystrophy beginning in the lower limbs. Final outcome depends on respiratory muscle failure. Patients with the adult form can be free of clinical symptoms for most of their life but finally develop a slowly progressive myopathy. {ECO:0000269|PubMed:10189220, ECO:0000269|PubMed:10206684, ECO:0000269|PubMed:10338092, ECO:0000269|PubMed:10737124, ECO:0000269|PubMed:11071489, ECO:0000269|PubMed:11738358, ECO:0000269|PubMed:12601120, ECO:0000269|PubMed:12923862, ECO:0000269|PubMed:14643388, ECO:0000269|PubMed:14695532, ECO:0000269|PubMed:14972326, ECO:0000269|PubMed:15145338, ECO:0000269|PubMed:15668445, ECO:0000269|PubMed:16433701, ECO:0000269|PubMed:1652892, ECO:0000269|PubMed:16782080, ECO:0000269|PubMed:1684505, ECO:0000269|PubMed:16917947, ECO:0000269|PubMed:17643989, ECO:0000269|PubMed:18425781, ECO:0000269|PubMed:18429042, ECO:0000269|PubMed:1898413, ECO:0000269|PubMed:19588081, ECO:0000269|PubMed:20080426, ECO:0000269|PubMed:20350966, ECO:0000269|PubMed:21109266, ECO:0000269|PubMed:22644586, ECO:0000269|PubMed:22676651, ECO:0000269|PubMed:25681614, ECO:0000269|PubMed:7695647, ECO:0000269|PubMed:7717400, ECO:0000269|PubMed:7866409, ECO:0000269|PubMed:7881422, ECO:0000269|PubMed:7981676, ECO:0000269|PubMed:8094613, ECO:0000269|PubMed:8401535, ECO:0000269|PubMed:8834250, ECO:0000269|PubMed:9521422, ECO:0000269|PubMed:9535769, ECO:0000269|PubMed:9660056, ECO:0000269|Ref.5}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- Starch and sucrose metabolism - Homo sapiens (human);Lysosome - Homo sapiens (human);Galactose metabolism - Homo sapiens (human);Galactose Metabolism;Galactosemia;Neutrophil degranulation;Metabolism of carbohydrates;Innate Immune System;Immune System;Metabolism;Galactose metabolism;Notch-mediated HES/HEY network;Glycogen breakdown (glycogenolysis);Glycogen metabolism
(Consensus)
Recessive Scores
- pRec
- 0.935
Intolerance Scores
- loftool
- 0.0315
- rvis_EVS
- -1.16
- rvis_percentile_EVS
- 6.1
Haploinsufficiency Scores
- pHI
- 0.117
- hipred
- N
- hipred_score
- 0.264
- ghis
- 0.498
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.524
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Gaa
- Phenotype
- muscle phenotype; cellular phenotype; homeostasis/metabolism phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); growth/size/body region phenotype; skeleton phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan);
Zebrafish Information Network
- Gene name
- gaa
- Affected structure
- skeletal muscle
- Phenotype tag
- abnormal
- Phenotype quality
- increased amount
Gene ontology
- Biological process
- maltose metabolic process;regulation of the force of heart contraction;diaphragm contraction;heart morphogenesis;glycogen catabolic process;sucrose metabolic process;glucose metabolic process;lysosome organization;locomotory behavior;tissue development;vacuolar sequestering;neutrophil degranulation;muscle cell cellular homeostasis;neuromuscular process controlling posture;neuromuscular process controlling balance;cardiac muscle contraction
- Cellular component
- lysosome;lysosomal membrane;plasma membrane;membrane;azurophil granule membrane;lysosomal lumen;extracellular exosome;tertiary granule membrane;ficolin-1-rich granule membrane
- Molecular function
- alpha-1,4-glucosidase activity;carbohydrate binding;maltose alpha-glucosidase activity;alpha-glucosidase activity