GAA

alpha glucosidase, the group of Glycoside hydrolase family 31

Basic information

Region (hg38): 17:80101533-80119881

Links

ENSG00000171298 ∙ NCBI:2548 ∙ OMIM:606800 ∙ HGNC:4065 ∙ Uniprot:P10253 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• glycogen storage disease II (Definitive), mode of inheritance: AR
• glycogen storage disease II (Strong), mode of inheritance: AR
• glycogen storage disease II (Strong), mode of inheritance: AR
• glycogen storage disease due to acid maltase deficiency, infantile onset (Supportive), mode of inheritance: AR
• glycogen storage disease due to acid maltase deficiency, late-onset (Supportive), mode of inheritance: AR
• glycogen storage disease II (Definitive), mode of inheritance: AR
• glycogen storage disease II (Strong), mode of inheritance: AR
• glycogen storage disease II (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Glycogen storage disease II	AR	Biochemical; Cardiovascular; Pharmacogenomic	Enzyme therapy is available; Disease-specific care of cardiomyopathy may be beneficial (eg, some standard drugs are contraindicated, and there is high risk for arrhythmias and sudden cardiac death)	Biochemical; Cardiovascular; Musculoskeletal; Neurologic; Pulmonary	5217754; 4288232; 5229488; 5247277; 5240358; 6810200; 6401355; 3084996; 3093639; 3090917; 3322184; 3135192; 3282727; 3288378; 2403755; 2243227; 2203258; 1895140; 11071489; 10931430; 11286229; 12601120; 12897283; 15668445; 15985590; 16433701; 17190962; 16917947; 19047571; 19047572; 20301438; 21543987; 21518733; 21637107; 22253258; 22334186; 22353292; 22365055; 22492103; 22538254; 22539577; 22581536; 22616199; 23884227; 24008937; 24011652; 24044919

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GAA gene.

• Glycogen storage disease, type II (299 variants)
• not provided (122 variants)
• Glycogen storage disease (5 variants)
• Glycogen storage disease II, adult form (4 variants)
• GAA-related disorder (4 variants)
• Glycogen storage disease type II, infantile (3 variants)
• Cardiovascular phenotype (2 variants)
• Glycogen storage disease due to glucose-6-phosphatase deficiency type IA (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GAA gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			13	572	9	594
missense	65	134	709	8	8	924
nonsense	75	25	1			101
start loss	3	3				6
frameshift	131	84	1			216
inframe indel	8	4	21			33
splice donor/acceptor (+/-2bp)	23	55	5			83
splice region	3	9	59	106	2	179
non coding	1	2	32	318	62	415
Total	306	307	782	898	79

Highest pathogenic variant AF is 0.000585

Variants in GAA

This is a list of pathogenic ClinVar variants found in the GAA region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
17-80101562-C-T			Likely benign (Aug 22, 2021)
17-80101585-C-G		Glycogen storage disease, type II • Primary ciliary dyskinesia	Benign/Likely benign (May 12, 2021)
17-80101598-C-T		Primary ciliary dyskinesia 15 • Glycogen storage disease, type II	Uncertain significance (Jan 13, 2018)
17-80101606-C-T		not specified	Likely benign (Dec 11, 2017)
17-80101611-C-T		Glycogen storage disease, type II • not specified • GAA-related disorder	Conflicting classifications of pathogenicity (Jan 22, 2020)
17-80101612-G-C		GAA-related disorder	Likely benign (Mar 29, 2021)
17-80101631-C-A		GAA-related disorder	Likely benign (Jul 12, 2024)
17-80101639-G-A		not specified	Likely benign (May 08, 2017)
17-80101663-G-C		Glycogen storage disease, type II • Primary ciliary dyskinesia	Benign/Likely benign (Jun 29, 2018)
17-80101687-C-T		Glycogen storage disease, type II	Uncertain significance (Jan 13, 2018)
17-80101745-G-A		Glycogen storage disease, type II • Primary ciliary dyskinesia	Benign/Likely benign (May 12, 2021)
17-80101807-C-T		Glycogen storage disease, type II	Conflicting classifications of pathogenicity (May 13, 2021)
17-80101819-C-T		not specified	Likely benign (Jan 26, 2017)
17-80101820-G-A			Likely benign (Jun 05, 2018)
17-80101848-C-G		Glycogen storage disease, type II • Primary ciliary dyskinesia 15	Likely benign (Mar 17, 2021)
17-80101861-A-C		Glycogen storage disease, type II	Uncertain significance (Jan 13, 2018)
17-80101879-G-A		GAA-related disorder	Likely benign (Jan 09, 2022)
17-80101886-A-G		not specified	Likely benign (Oct 07, 2016)
17-80101907-C-T		not specified	Likely benign (Mar 01, 2017)
17-80102109-G-C			Benign (Jul 03, 2018)
17-80104166-AAGTGGGAGGATTGCTTGAGTCTGGGAGGTGGAGGTTGCAGTGAGCCAGGATCTCACCACAGCACTCTGGCCCAGGCGACAGCTGTTTGGCCTGTTTCAAGTGTCTACCTGCCTTGCTGGTCTTCCTGGGGACATTCTAAGCGTGTTTGATTTGTAACATTTTAGCAGACTGTGCAAGTGCTCTGCACTCCCCTGCTGGAGCTTTTCTCGCCCTTCCTTCTGGCCCTCTCCCCAGTCTAGACAGCAGGGCAACACCCACCCTGGCCACCTTACCCCACCTGCCTGGGTGCTGCAGTGCCAGCCGCGGTTGATGTCTCAGAGCTGCTTTGAGAGCCCCGTGAGTGCCGCCCCTCCCGCCTCCCTGCTGAGCCCGCTTTCTTCTCCCGCAGGCCTGTAGGAGCTGTCCAGGCCATCTCCAACCATGGGAGTGAGGCACCCGCCCTGCTCCCACCGGCTCCTGGCCGTCTGCGCCCTCGTGTCCTTGGCAACCGCTGCACTCCTGGGGCACATCCTACTCCATGATTTCCTGCTGGTTCCCCGAGAGCTGAGTGGCTCCTCCCC-A		Glycogen storage disease, type II	Pathogenic (Jul 19, 2023)
17-80104374-C-T			Likely benign (Jun 16, 2018)
17-80104471-G-A			Likely benign (Jul 14, 2018)
17-80104537-C-G		Glycogen storage disease type II, infantile	Uncertain significance (Feb 19, 2019)
17-80104538-G-A		GAA-related disorder	Likely benign (-)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GAA	protein_coding	protein_coding	ENST00000302262	19	18324

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
2.82e-18	0.360	125568	0	178	125746	0.000708

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.633	646	602	1.07	0.0000408	6128
Missense in Polyphen		214	204.02	1.0489		2086
Synonymous	-0.901	290	271	1.07	0.0000207	1986
Loss of Function	1.66	34	46.1	0.737	0.00000236	447

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00339	0.00335
Ashkenazi Jewish	0.000101	0.0000992
East Asian	0.000764	0.000761
Finnish	0.000375	0.000370
European (Non-Finnish)	0.000705	0.000668
Middle Eastern	0.000764	0.000761
South Asian	0.000401	0.000392
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Essential for the degradation of glycogen in lysosomes (PubMed:1856189, PubMed:7717400, PubMed:14695532, PubMed:18429042). Has highest activity on alpha-1,4-linked glycosidic linkages, but can also hydrolyze alpha-1,6-linked glucans (PubMed:29061980). {ECO:0000269|PubMed:14695532, ECO:0000269|PubMed:18429042, ECO:0000269|PubMed:1856189, ECO:0000269|PubMed:29061980, ECO:0000269|PubMed:7717400}.
• Disease: DISEASE: Glycogen storage disease 2 (GSD2) [MIM:232300]: A metabolic disorder with a broad clinical spectrum. The severe infantile form, or Pompe disease, presents at birth with massive accumulation of glycogen in muscle, heart and liver. Cardiomyopathy and muscular hypotonia are the cardinal features of this form whose life expectancy is less than two years. The juvenile and adult forms present as limb-girdle muscular dystrophy beginning in the lower limbs. Final outcome depends on respiratory muscle failure. Patients with the adult form can be free of clinical symptoms for most of their life but finally develop a slowly progressive myopathy. {ECO:0000269|PubMed:10189220, ECO:0000269|PubMed:10206684, ECO:0000269|PubMed:10338092, ECO:0000269|PubMed:10737124, ECO:0000269|PubMed:11071489, ECO:0000269|PubMed:11738358, ECO:0000269|PubMed:12601120, ECO:0000269|PubMed:12923862, ECO:0000269|PubMed:14643388, ECO:0000269|PubMed:14695532, ECO:0000269|PubMed:14972326, ECO:0000269|PubMed:15145338, ECO:0000269|PubMed:15668445, ECO:0000269|PubMed:16433701, ECO:0000269|PubMed:1652892, ECO:0000269|PubMed:16782080, ECO:0000269|PubMed:1684505, ECO:0000269|PubMed:16917947, ECO:0000269|PubMed:17643989, ECO:0000269|PubMed:18425781, ECO:0000269|PubMed:18429042, ECO:0000269|PubMed:1898413, ECO:0000269|PubMed:19588081, ECO:0000269|PubMed:20080426, ECO:0000269|PubMed:20350966, ECO:0000269|PubMed:21109266, ECO:0000269|PubMed:22644586, ECO:0000269|PubMed:22676651, ECO:0000269|PubMed:25681614, ECO:0000269|PubMed:7695647, ECO:0000269|PubMed:7717400, ECO:0000269|PubMed:7866409, ECO:0000269|PubMed:7881422, ECO:0000269|PubMed:7981676, ECO:0000269|PubMed:8094613, ECO:0000269|PubMed:8401535, ECO:0000269|PubMed:8834250, ECO:0000269|PubMed:9521422, ECO:0000269|PubMed:9535769, ECO:0000269|PubMed:9660056, ECO:0000269|Ref.5}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Starch and sucrose metabolism - Homo sapiens (human);Lysosome - Homo sapiens (human);Galactose metabolism - Homo sapiens (human);Galactose Metabolism;Galactosemia;Neutrophil degranulation;Metabolism of carbohydrates;Innate Immune System;Immune System;Metabolism;Galactose metabolism;Notch-mediated HES/HEY network;Glycogen breakdown (glycogenolysis);Glycogen metabolism (Consensus)

Recessive Scores

• pRec: 0.935

Intolerance Scores

• loftool: 0.0315
• rvis_EVS: -1.16
• rvis_percentile_EVS: 6.1

Haploinsufficiency Scores

• pHI: 0.117
• hipred: N
• hipred_score: 0.264
• ghis: 0.498

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.524

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gaa
• Phenotype: muscle phenotype; cellular phenotype; homeostasis/metabolism phenotype; cardiovascular system phenotype (the observable morphological and physiological characteristics of the mammalian heart, blood vessels, or circulatory system that are manifested through development and lifespan); growth/size/body region phenotype; skeleton phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan)

Zebrafish Information Network

• Gene name: gaa
• Affected structure: skeletal muscle
• Phenotype tag: abnormal
• Phenotype quality: increased amount

Gene ontology

• Biological process: maltose metabolic process;regulation of the force of heart contraction;diaphragm contraction;heart morphogenesis;glycogen catabolic process;sucrose metabolic process;glucose metabolic process;lysosome organization;locomotory behavior;tissue development;vacuolar sequestering;neutrophil degranulation;muscle cell cellular homeostasis;neuromuscular process controlling posture;neuromuscular process controlling balance;cardiac muscle contraction
• Cellular component: lysosome;lysosomal membrane;plasma membrane;membrane;azurophil granule membrane;lysosomal lumen;extracellular exosome;tertiary granule membrane;ficolin-1-rich granule membrane
• Molecular function: alpha-1,4-glucosidase activity;carbohydrate binding;maltose alpha-glucosidase activity;alpha-glucosidase activity