GCK
glucokinase
Basic information
Region (hg38): 7:44143213-44198170
Previous symbols: [ "MODY2" ]
Links
Phenotypes
GenCC
Source:
- maturity-onset diabetes of the young type 2 (Strong), mode of inheritance: AD
- diabetes mellitus, noninsulin-dependent (Strong), mode of inheritance: AD
- hyperinsulinism due to glucokinase deficiency (Strong), mode of inheritance: AD
- permanent neonatal diabetes mellitus 1 (Strong), mode of inheritance: AR
- transient neonatal diabetes mellitus (Strong), mode of inheritance: AR
- maturity-onset diabetes of the young type 2 (Definitive), mode of inheritance: AD
- maturity-onset diabetes of the young (Supportive), mode of inheritance: AD
- hyperinsulinism due to glucokinase deficiency (Supportive), mode of inheritance: AD
- permanent neonatal diabetes mellitus (Supportive), mode of inheritance: AD
- hyperinsulinism due to glucokinase deficiency (Definitive), mode of inheritance: AD
- permanent neonatal diabetes mellitus 1 (Moderate), mode of inheritance: AR
- hyperinsulinism due to glucokinase deficiency (Strong), mode of inheritance: AD
- maturity-onset diabetes of the young type 2 (Strong), mode of inheritance: AD
- permanent neonatal diabetes mellitus 1 (Strong), mode of inheritance: AR
- monogenic diabetes (Definitive), mode of inheritance: AD
Clinical Genomic Database
Source:
| Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
|---|---|---|---|---|---|
| Diabetes mellitus, permanent neonatal 1; Maturity-onset diabetes of the young, type 2; Hyperinsulinemic hypoglycemia, familial 3 | AD/AR | Endocrine | Individuals with Diabetes mellitus, permanent neonatal have been described with early-onset diabetes mellitus, and recognition may allow prompt early care (eg, with rehydration and insulin), as well as decisions regarding longer-term care (eg, some patients with variants in certain genes may respond to specific medications); In Hyperinsulinemic hypoglycemia, familial, recognition may allow prompt treatment of hypoglycemia; At initial diagnosis, hypoglycemia can be corrected with IV glucose in order to prevent brain damage; Long-term management includes diazoxide, somatostatin analogs, nifedipine, glucagon, recombinant IGF-I, glucocorticoids, human growth hormone, and dietary intervention; If aggressive medical management fails or is not possible (for example, in the case of some individuals with severe AR disease), pancreatic resection may be considered; In MODY, recognition of the underlying cause of MODY may help direct specific management strategies (eg, choice of medications) | Endocrine | 1360036; 1303265; 1545870; 1570017; 8376578; 8446612; 9435328; 9662401; 9469993; 11372010; 11916951; 14517946; 12941786; 15277402; 16965331; 17204055; 18399931; 18571549; 20301549; 20375417; 20301620 |
ClinVar
This is a list of variants' phenotypes submitted to
- Monogenic diabetes (158 variants)
- not provided (148 variants)
- Maturity-onset diabetes of the young type 2 (77 variants)
- Maturity onset diabetes mellitus in young (75 variants)
- GCK-related disorder (17 variants)
- not specified (6 variants)
- Permanent neonatal diabetes mellitus (5 variants)
- Hyperinsulinism due to glucokinase deficiency (4 variants)
- Type 2 diabetes mellitus;Hyperinsulinism due to glucokinase deficiency;Maturity-onset diabetes of the young type 2;Permanent neonatal diabetes mellitus 1 (3 variants)
- Permanent neonatal diabetes mellitus 1 (3 variants)
- Gestational diabetes (3 variants)
- Type 2 diabetes mellitus;Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus 1;Maturity-onset diabetes of the young type 2 (2 variants)
- Hyperinsulinism due to glucokinase deficiency;Type 2 diabetes mellitus;Maturity-onset diabetes of the young type 2;Permanent neonatal diabetes mellitus 1 (2 variants)
- Type 2 diabetes mellitus (2 variants)
- Maturity-onset diabetes of the young type 2;Type 2 diabetes mellitus;Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus 1 (2 variants)
- Type 2 diabetes mellitus;Permanent neonatal diabetes mellitus 1;Hyperinsulinism due to glucokinase deficiency;Maturity-onset diabetes of the young type 2 (2 variants)
- Maturity-onset diabetes of the young type 2;Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus;Type 2 diabetes mellitus (1 variants)
- Maturity-onset diabetes of the young type 3 (1 variants)
- Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus 1;Maturity-onset diabetes of the young type 2;Type 2 diabetes mellitus (1 variants)
- Hyperinsulinism due to glucokinase deficiency;Type 2 diabetes mellitus;Permanent neonatal diabetes mellitus;Maturity-onset diabetes of the young type 2 (1 variants)
- Type 2 diabetes mellitus;Maturity-onset diabetes of the young type 2;Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus 1 (1 variants)
- Pancytopenia-developmental delay syndrome (1 variants)
- Permanent neonatal diabetes mellitus;Hyperinsulinism due to glucokinase deficiency;Type 2 diabetes mellitus;Maturity-onset diabetes of the young type 2 (1 variants)
- Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus 1;Type 2 diabetes mellitus;Maturity-onset diabetes of the young type 2 (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the GCK gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
| Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
|---|---|---|---|---|---|---|
| synonymous | 10 | 61 | 73 | |||
| missense | 123 | 185 | 215 | 532 | ||
| nonsense | 41 | 17 | 58 | |||
| start loss | 2 | |||||
| frameshift | 56 | 49 | 105 | |||
| inframe indel | 12 | 20 | ||||
| splice donor/acceptor (+/-2bp) | 28 | 12 | 41 | |||
| splice region | 4 | 9 | 16 | 5 | 1 | 35 |
| non coding | 19 | 44 | 29 | 99 | ||
| Total | 253 | 273 | 258 | 110 | 36 |
Highest pathogenic variant AF is 0.0000131
Variants in GCK
This is a list of pathogenic ClinVar variants found in the GCK region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
| Position | Type | Phenotype | Significance | ClinVar |
|---|---|---|---|---|
| 7-44144289-C-T | Transient Neonatal Diabetes, Recessive • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity-onset diabetes of the young type 2 • Maturity onset diabetes mellitus in young | Benign/Likely benign (Jan 13, 2018) | ||
| 7-44144292-T-G | Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity-onset diabetes of the young type 2 • Transient Neonatal Diabetes, Recessive • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 12, 2018) | ||
| 7-44144339-G-A | Hyperinsulinism due to glucokinase deficiency • Maturity-onset diabetes of the young type 2 • Permanent neonatal diabetes mellitus • Transient Neonatal Diabetes, Recessive • Maturity onset diabetes mellitus in young | Benign (May 21, 2021) | ||
| 7-44144372-G-A | Maturity-onset diabetes of the young type 2 • Transient Neonatal Diabetes, Recessive • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 7-44144376-TG-T | Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young • Hyperinsulinism, Dominant • Transient Neonatal Diabetes, Recessive | Benign (May 12, 2021) | ||
| 7-44144401-G-T | Transient Neonatal Diabetes, Recessive • Permanent neonatal diabetes mellitus • Hyperinsulinism due to glucokinase deficiency • Maturity-onset diabetes of the young type 2 • Maturity onset diabetes mellitus in young | Benign/Likely benign (Jan 12, 2018) | ||
| 7-44144413-T-C | Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 7-44144415-G-A | Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 7-44144458-C-A | Maturity-onset diabetes of the young type 2 • Transient Neonatal Diabetes, Recessive • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 7-44144588-C-T | Hyperinsulinism due to glucokinase deficiency • Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 12, 2018) | ||
| 7-44144626-G-A | Permanent neonatal diabetes mellitus • Maturity-onset diabetes of the young type 2 • Transient Neonatal Diabetes, Recessive • Hyperinsulinism due to glucokinase deficiency • Maturity onset diabetes mellitus in young | Benign/Likely benign (Jan 13, 2018) | ||
| 7-44144659-G-A | Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Maturity onset diabetes mellitus in young | Benign (May 12, 2021) | ||
| 7-44144780-C-T | Permanent neonatal diabetes mellitus • Transient Neonatal Diabetes, Recessive • Hyperinsulinism due to glucokinase deficiency • Maturity-onset diabetes of the young type 2 • Maturity onset diabetes mellitus in young | Benign/Likely benign (Jan 13, 2018) | ||
| 7-44144804-C-T | Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus | Benign (Jan 12, 2018) | ||
| 7-44144839-A-C | Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Benign/Likely benign (Jan 12, 2018) | ||
| 7-44144866-G-A | Hyperinsulinism due to glucokinase deficiency • Maturity-onset diabetes of the young type 2 • Transient Neonatal Diabetes, Recessive • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Jan 13, 2018) | ||
| 7-44145009-GGCCTGGGTCCTGACAAGGCCAGGCCTCCTGCCCCGCCAGGCTGCGAGCACGTGTGGGGAGCACTTCCCCATGGAGCCTGGGTGCTGTGGGGCTGTGGCATCCTCCCTGCGCTTGCGGCCACTGCTCTCACTGGCCCAGCATACAGGCCTTCTTACAGGCCACCGCCG-A | Monogenic diabetes | Likely pathogenic (Jun 20, 2023) | ||
| 7-44145044-G-T | Maturity-onset diabetes of the young type 2 • Permanent neonatal diabetes mellitus • Transient Neonatal Diabetes, Recessive • Hyperinsulinism due to glucokinase deficiency • Maturity onset diabetes mellitus in young | Benign/Likely benign (Apr 08, 2020) | ||
| 7-44145124-C-T | Hyperinsulinism due to glucokinase deficiency;Permanent neonatal diabetes mellitus 1;Type 2 diabetes mellitus;Maturity-onset diabetes of the young type 2 | Uncertain significance (Jan 15, 2024) | ||
| 7-44145125-G-A | not specified • Transient Neonatal Diabetes, Recessive • Maturity-onset diabetes of the young type 2 • Hyperinsulinism due to glucokinase deficiency • Permanent neonatal diabetes mellitus • Maturity onset diabetes mellitus in young | Conflicting classifications of pathogenicity (Sep 01, 2022) | ||
| 7-44145133-CTCTCACTGGCCCAGCATACAGG-C | Monogenic diabetes | Likely pathogenic (Jun 18, 2023) | ||
| 7-44145136-T-A | Monogenic diabetes | Pathogenic (Jan 02, 2024) | ||
| 7-44145136-T-C | Monogenic diabetes | Likely pathogenic (Aug 10, 2023) | ||
| 7-44145138-A-G | Monogenic diabetes | Likely pathogenic (Aug 10, 2023) | ||
| 7-44145141-GGC-G | Monogenic diabetes | Likely pathogenic (Mar 24, 2023) |
GnomAD
Source:
| Gene | Type | Bio Type | Transcript | Coding Exons | Length |
|---|---|---|---|---|---|
| GCK | protein_coding | protein_coding | ENST00000345378 | 10 | 53898 |
| pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
|---|---|---|---|---|---|---|
| 0.635 | 0.365 | 125635 | 0 | 7 | 125642 | 0.0000279 |
| Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
|---|---|---|---|---|---|---|
| Missense | 3.07 | 148 | 297 | 0.499 | 0.0000193 | 3047 |
| Missense in Polyphen | 48 | 123.79 | 0.38776 | 1254 | ||
| Synonymous | 0.274 | 126 | 130 | 0.969 | 0.00000998 | 894 |
| Loss of Function | 3.40 | 4 | 20.7 | 0.194 | 9.01e-7 | 240 |
LoF frequencies by population
| Ethnicity | Sum of pLOFs | p |
|---|---|---|
| African & African-American | 0.00 | 0.00 |
| Ashkenazi Jewish | 0.00 | 0.00 |
| East Asian | 0.00 | 0.00 |
| Finnish | 0.00 | 0.00 |
| European (Non-Finnish) | 0.0000455 | 0.0000440 |
| Middle Eastern | 0.00 | 0.00 |
| South Asian | 0.0000327 | 0.0000327 |
| Other | 0.000174 | 0.000163 |
dbNSFP
Source:
- Function
- FUNCTION: Catalyzes the initial step in utilization of glucose by the beta-cell and liver at physiological glucose concentration. Glucokinase has a high Km for glucose, and so it is effective only when glucose is abundant. The role of GCK is to provide G6P for the synthesis of glycogen. Pancreatic glucokinase plays an important role in modulating insulin secretion. Hepatic glucokinase helps to facilitate the uptake and conversion of glucose by acting as an insulin-sensitive determinant of hepatic glucose usage. {ECO:0000269|PubMed:11916951, ECO:0000269|PubMed:15277402, ECO:0000269|PubMed:17082186, ECO:0000269|PubMed:18322640, ECO:0000269|PubMed:19146401, ECO:0000269|PubMed:25015100, ECO:0000269|PubMed:8325892}.;
- Disease
- DISEASE: Familial hyperinsulinemic hypoglycemia 3 (HHF3) [MIM:602485]: Most common cause of persistent hypoglycemia in infancy. Unless early and aggressive intervention is undertaken, brain damage from recurrent episodes of hypoglycemia may occur. {ECO:0000269|PubMed:11916951, ECO:0000269|PubMed:12941786, ECO:0000269|PubMed:15277402, ECO:0000269|PubMed:17082186, ECO:0000269|PubMed:19884385, ECO:0000269|PubMed:20375417, ECO:0000269|PubMed:28247534, ECO:0000269|PubMed:9435328}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Diabetes mellitus, non-insulin-dependent (NIDDM) [MIM:125853]: A multifactorial disorder of glucose homeostasis caused by a lack of sensitivity to the body's own insulin. Affected individuals usually have an obese body habitus and manifestations of a metabolic syndrome characterized by diabetes, insulin resistance, hypertension and hypertriglyceridemia. The disease results in long-term complications that affect the eyes, kidneys, nerves, and blood vessels. {ECO:0000269|PubMed:1360036}. Note=Disease susceptibility is associated with variations affecting the gene represented in this entry.; DISEASE: Diabetes mellitus, permanent neonatal (PNDM) [MIM:606176]: A rare form of diabetes distinct from childhood- onset autoimmune diabetes mellitus type 1. It is characterized by insulin-requiring hyperglycemia that is diagnosed within the first months of life. Permanent neonatal diabetes requires lifelong therapy. {ECO:0000269|PubMed:11372010, ECO:0000269|PubMed:25015100}. Note=The disease is caused by mutations affecting the gene represented in this entry.;
- Pathway
- UDP-<i>N</i>-acetyl-D-galactosamine biosynthesis II;Glycolysis / Gluconeogenesis - Homo sapiens (human);Central carbon metabolism in cancer - Homo sapiens (human);Type II diabetes mellitus - Homo sapiens (human);Starch and sucrose metabolism - Homo sapiens (human);Maturity onset diabetes of the young - Homo sapiens (human);Glucagon signaling pathway - Homo sapiens (human);Prolactin signaling pathway - Homo sapiens (human);Galactose metabolism - Homo sapiens (human);Neomycin, kanamycin and gentamicin biosynthesis - Homo sapiens (human);Amino sugar and nucleotide sugar metabolism - Homo sapiens (human);Insulin signaling pathway - Homo sapiens (human);Insulin secretion - Homo sapiens (human);Anti-diabetic Drug Potassium Channel Inhibitors Pathway, Pharmacodynamics;Galactosemia III;Galactosemia II (GALK);Glycogen synthetase deficiency;Glycogenosis, Type III. Cori disease, Debrancher glycogenosis;Mucopolysaccharidosis VI. Sly syndrome;Sucrase-isomaltase deficiency;Glycogenosis, Type IV. Amylopectinosis, Anderson disease;Glycogenosis, Type VI. Hers disease;Galactose Metabolism;Trehalose Degradation;Starch and Sucrose Metabolism;Nucleotide Sugars Metabolism;Galactosemia;Glycolysis and Gluconeogenesis;Sudden Infant Death Syndrome (SIDS) Susceptibility Pathways;Aminosugars metabolism;mapkinase signaling pathway;Metabolism of carbohydrates;Fructose Mannose metabolism;Glycolysis Gluconeogenesis;Metabolism;Regulation of Glucokinase by Glucokinase Regulatory Protein;Glycolysis;GDP-glucose biosynthesis II;trehalose degradation;glycolysis;superpathway of conversion of glucose to acetyl CoA and entry into the TCA cycle;Glucose metabolism;HIF-1-alpha transcription factor network;FOXA2 and FOXA3 transcription factor networks;Galactose metabolism
(Consensus)
Recessive Scores
- pRec
- 0.742
Intolerance Scores
- loftool
- 0.00723
- rvis_EVS
- -0.36
- rvis_percentile_EVS
- 28.93
Haploinsufficiency Scores
- pHI
- 0.813
- hipred
- Y
- hipred_score
- 0.748
- ghis
- 0.572
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.864
Gene Damage Prediction
| All | Recessive | Dominant | |
|---|---|---|---|
| Mendelian | Medium | Medium | Medium |
| Primary Immunodeficiency | Medium | Medium | Medium |
| Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Gck
- Phenotype
- liver/biliary system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); hematopoietic system phenotype; renal/urinary system phenotype; growth/size/body region phenotype; endocrine/exocrine gland phenotype; homeostasis/metabolism phenotype;
Zebrafish Information Network
- Gene name
- gck
- Affected structure
- pancreatic B cell
- Phenotype tag
- abnormal
- Phenotype quality
- decreased area
Gene ontology
- Biological process
- cellular glucose homeostasis;glycolytic process;regulation of glycolytic process;NADP metabolic process;positive regulation of insulin secretion;cellular response to insulin stimulus;glucose homeostasis;regulation of potassium ion transport;cellular response to leptin stimulus;negative regulation of gluconeogenesis;positive regulation of glycogen biosynthetic process;carbohydrate phosphorylation;regulation of insulin secretion;glucose 6-phosphate metabolic process;detection of glucose;canonical glycolysis;calcium ion import
- Cellular component
- nucleoplasm;mitochondrion;cytosol
- Molecular function
- glucokinase activity;protein binding;ATP binding;glucose binding;fructokinase activity;mannokinase activity