GCSH

glycine cleavage system protein H

Basic information

Region (hg38): 16:81081944-81096395

Links

ENSG00000140905 ∙ NCBI:2653 ∙ OMIM:238330 ∙ HGNC:4208 ∙ Uniprot:P23434 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• glycine encephalopathy (Strong), mode of inheritance: AR
• glycine encephalopathy (Limited), mode of inheritance: AR
• neonatal glycine encephalopathy (Supportive), mode of inheritance: AR
• infantile glycine encephalopathy (Supportive), mode of inheritance: AR
• atypical glycine encephalopathy (Supportive), mode of inheritance: Unknown
• multiple mitochondrial dysfunctions syndrome 7 (Strong), mode of inheritance: AR
• glycine encephalopathy (Strong), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Glycine encephalopathy	AR	Biochemical	There is no current effective treatment for severe disease, but children with variants associated with residual GCS enzyme activity treated aggressively early with sodium benzoate and N-methyl D-aspartate receptor site antagonists may have improved outcomes	Biochemical; Neurologic; Ophthalmologic	6790577; 12402263; 20301531; 21470805; 33890291; 36190515

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GCSH gene.

• Non-ketotic hyperglycinemia (70 variants)
• not provided (37 variants)
• Inborn genetic diseases (13 variants)
• Multiple mitochondrial dysfunctions syndrome 7 (2 variants)
• GCSH-related condition (2 variants)
• not specified (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GCSH gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				15	4	19
missense			44		2	46
nonsense		1				1
start loss		1	1			2
frameshift	1					1
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region			2	4		6
non coding				4	23	27
Total	1	2	45	19	29

Variants in GCSH

This is a list of pathogenic ClinVar variants found in the GCSH region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
16-81082702-G-C			Benign (May 20, 2021)
16-81082778-T-G			Benign (May 12, 2021)
16-81082793-C-CTATCCACCACTAATTTAAGACAACTCTGCTGGCTTGCGTTATTTCATACTAGTTTATTTAGGAGTTCCATTTTCACTCCTCAATAGATTTTATGTATTTCTCATATGCTTCTTCACTCATAAGTTCATCTAGTTCTGAAGGGTTACTCAGTGTCATCTTGATCAGCCAACCTGCAACCAAAAGACAACCTTATATTCCACATTAACTTTTTAAAAAGTCAAATTCATCCAAAACGTAAAATAAATTTCTGAGCGCCTCAATCTTGTATTCTTTACAAAAACCATACATTATTTGTTCATAGAACTTTAAATTTTAGCCTTAAGAATTAAAATACTTGTATATAACAAATGAAAATAATTATGGCTAGAATAGATTCCACCATAATAAATTAAGAACTCTTAGGTTGTAATAAGCATCAGAAAATGACATTTAAATCTTTAAGGGCCGGGCACGGTGGCTCATGCCTGTAATCCCAGTACTTTGGGAAGCGAAGGCAAGCAAATCACTTGAGGCTAGGAGCTCTAGACCAGCCTGGCCAACATAGTGGAACCCCATCTCTACCAAAACCACAAAAATTAGCTGGGCGTGGTGGCAGTTGCCCTTGATCCCAGCTACTGGGAAGCTGAGGCAGAAGAAGTGCTTGAACCCGAGAAGGGGAGGTTGCAGTGCACCGAGATCACGCCACTGCACTCCAGCCTGGGCGACAGAGGGAGACTCTGTCTCAAAAAAATAATAAAAATAAGTCCTTAAATATATGATCCAAATACACAAGACCAGGTATGTCTTTAACAAATGGAACACTAACTACTGAGGTTAACGGGATTAGAAAGCAGTAGTAATTAGAAGGGCTAGGTGACAGACAAAAGAGAACTACAACCTAATCCTAGCTTTGCCATTTATCAGCCATGAGACCCTGACAGATAAATCCTTTGGAGCCTCTATTCATCTACAAAATAGAGAAAATTGCTGTTAGCTTACCTGATTAGATTATAAGGGTGAAAATGTGAGAAAACCAAAAATTAATGCAAAATATATATTTTTTTACCTCCCATGTCACACAATATGAGTGGCTGCTTTATGTCTGAAAAAGTAAATACTTTGCAGATGTTTACACCAAAACCAAAGAATCTACAACTGATATCAAGAAACTGCAAAATAAGGTAATGCTTTTATCATCAGAGATTTTTTTTTCTTTTTTTGAGAAGGTCTCGCTCTGTCACTCAGGCTGGAGTGGAGTGGTGCGATCTTGGCTCACTATAGACTGCAGCCTTGACCTCCCAGGTTCAAGCAATTCTCCCACCTCAGCCTCCCTAGTAACTGAGACTACAGGCACATTCCACCACAGCCAGCTAATTTTTGTATTTCTATAGAGACAGAGTTTCACCATGTTGCCCAGGCTGGTCTCCAACTCCTGGACTAAAGCAATCCACCCACCTTGGCCTCCCAAAGTGCTGGGATCACAGGCGCGAGCCACTGCGCCTAGCCAGAAATCTTAAACATAACTTTAAGTATTCAACTAACCTCTGTTTTTCTTTTAAAGCAGAACATCTCTATTTAGTACCAAGAAGTAGAAAAAGATGAAGTCACAATCAGCTAAACTTGCTTTAAATTCTAGATAAAATATTTACTGTAGTAGTAATTCCTTGAGAAATTTCTAGCAACAGCTTACCATCTTCATAACAAGATTTGTTTACAAGTCCTGGATTTTCTGCAAGAGCTTCATTAATTTCAGTTACTTCTCCTGATAAAGGAGAATAGAGTTCACTAGCAGCTTTCACACTTTCCAAAGCACCAAACTCATCTAAGTGGAAAAAAAATTAAAGAAAACATGAAATGTTAAAAGTCAGTTACTTGAAAACAT		Multiple mitochondrial dysfunctions syndrome 7	Pathogenic (Jun 21, 2023)
16-81082874-C-T		Non-ketotic hyperglycinemia	Uncertain significance (Oct 26, 2020)
16-81082876-A-G		Non-ketotic hyperglycinemia	Uncertain significance (Feb 07, 2019)
16-81082877-T-A		Non-ketotic hyperglycinemia	Uncertain significance (Dec 13, 2019)
16-81082883-T-G		Non-ketotic hyperglycinemia	Uncertain significance (Apr 12, 2021)
16-81082886-T-C		Non-ketotic hyperglycinemia	Uncertain significance (Jul 12, 2022)
16-81082942-A-G		Non-ketotic hyperglycinemia	Uncertain significance (Aug 28, 2021)
16-81082945-G-A		Inborn genetic diseases	Uncertain significance (Apr 18, 2023)
16-81082963-C-A		Non-ketotic hyperglycinemia	Uncertain significance (Sep 01, 2022)
16-81082964-C-A		Non-ketotic hyperglycinemia	Likely pathogenic (-)
16-81082971-C-G		Non-ketotic hyperglycinemia	Likely benign (Jul 03, 2020)
16-81082981-C-T		Non-ketotic hyperglycinemia	Likely benign (Nov 11, 2020)
16-81084301-A-C			Benign (May 12, 2021)
16-81084464-A-G		Non-ketotic hyperglycinemia	Uncertain significance (Feb 17, 2020)
16-81084474-C-T		Non-ketotic hyperglycinemia	Uncertain significance (Jan 30, 2020)
16-81084487-C-T		Non-ketotic hyperglycinemia	Uncertain significance (Jan 14, 2021)
16-81084491-T-C			Likely benign (Jul 06, 2018)
16-81084512-T-C		Non-ketotic hyperglycinemia	Likely benign (Nov 09, 2020)
16-81084523-C-T		Non-ketotic hyperglycinemia	Uncertain significance (Nov 03, 2022)
16-81084543-G-A		Multiple mitochondrial dysfunctions syndrome 7	Pathogenic (Sep 05, 2023)
16-81084544-GAGAAT-G		Non-ketotic hyperglycinemia	Pathogenic (Sep 19, 2022)
16-81084558-C-T		Non-ketotic hyperglycinemia	Uncertain significance (Nov 05, 2020)
16-81084569-C-T		Non-ketotic hyperglycinemia	Likely benign (Dec 22, 2021)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GCSH	protein_coding	protein_coding	ENST00000315467	5	14443

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00160	0.709	125712	0	22	125734	0.0000875

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.0920	70	72.2	0.970	0.00000354	1068
Missense in Polyphen		12	20.284	0.59159		287
Synonymous	1.04	19	25.7	0.739	0.00000142	341
Loss of Function	0.791	5	7.31	0.684	3.07e-7	105

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000154	0.000149
Ashkenazi Jewish	0.00	0.00
East Asian	0.000163	0.000163
Finnish	0.00	0.00
European (Non-Finnish)	0.0000797	0.0000791
Middle Eastern	0.000163	0.000163
South Asian	0.000196	0.000196
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: The glycine cleavage system catalyzes the degradation of glycine. The H protein (GCSH) shuttles the methylamine group of glycine from the P protein (GLDC) to the T protein (GCST). {ECO:0000269|PubMed:1671321}.
• Disease: DISEASE: Non-ketotic hyperglycinemia (NKH) [MIM:605899]: Autosomal recessive disease characterized by accumulation of a large amount of glycine in body fluid and by severe neurological symptoms. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Glycine, serine and threonine metabolism - Homo sapiens (human);Glyoxylate and dicarboxylate metabolism - Homo sapiens (human);Ammonia Recycling;Glycine degradation;Metabolism of amino acids and derivatives;Metabolism;Glyoxylate metabolism and glycine degradation (Consensus)

Recessive Scores

• pRec: 0.164

Intolerance Scores

• loftool: 0.708
• rvis_EVS: 0.19
• rvis_percentile_EVS: 66.57

Haploinsufficiency Scores

• pHI: 0.749
• hipred: N
• hipred_score: 0.198
• ghis: 0.513

Essentials

• essential_gene_CRISPR: E
• essential_gene_CRISPR2: S
• essential_gene_gene_trap: K
• gene_indispensability_pred: E
• gene_indispensability_score: 0.871

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gcsh

Gene ontology

• Biological process: glycine catabolic process;protein lipoylation;glycine decarboxylation via glycine cleavage system;methylation
• Cellular component: mitochondrion;mitochondrial matrix;glycine cleavage complex
• Molecular function: aminomethyltransferase activity;protein binding