GIPC3

GIPC PDZ domain containing family member 3, the group of PDZ domain containing

Basic information

Region (hg38): 19:3585477-3593541

Previous symbols: [ "C19orf64", "DFNB72", "DFNB15" ]

Links

ENSG00000179855 ∙ NCBI:126326 ∙ OMIM:608792 ∙ HGNC:18183 ∙ Uniprot:Q8TF64 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• autosomal recessive nonsyndromic hearing loss 15 (Strong), mode of inheritance: AR
• autosomal recessive nonsyndromic hearing loss 15 (Strong), mode of inheritance: AR
• autosomal recessive nonsyndromic hearing loss 15 (Moderate), mode of inheritance: AR
• hearing loss, autosomal recessive (Supportive), mode of inheritance: AR
• nonsyndromic genetic hearing loss (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Deafness, autosomal recessive 15	AR	Audiologic/Otolaryngologic	Early recognition and treatment of hearing impairment may improve outcomes, including speech and language development	Audiologic/Otolaryngologic	9286457; 9106521; 17690910; 21326233; 21660509; 23226338; 23510777

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GIPC3 gene.

• not provided (127 variants)
• not specified (49 variants)
• Inborn genetic diseases (10 variants)
• Autosomal recessive nonsyndromic hearing loss 15 (10 variants)
• Hearing impairment (4 variants)
• Rare genetic deafness (3 variants)
• Sensorineural hearing loss disorder (1 variants)
• Hearing loss, autosomal recessive (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GIPC3 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			2	28	1	31
missense	1		58	3		62
nonsense						0
start loss						0
frameshift	2					2
inframe indel						0
splice donor/acceptor (+/-2bp)	1			1		2
splice region			1	7	2	10
non coding			4	30	15	49
Total	4	0	64	62	16

Variants in GIPC3

This is a list of pathogenic ClinVar variants found in the GIPC3 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
19-3585521-G-A			Benign (Jun 24, 2018)
19-3585552-G-C			Likely benign (Jul 10, 2018)
19-3585583-C-T		not specified	Uncertain significance (Nov 30, 2016)
19-3585597-CATGGAGGGAGCAGCGGCCCGGGAGGCCCGGGGGACCGAGACCCCGCGCGCGTCTGCGCCCCCGCCCGCGCCCTCGGAGCCCCCGGCCGCGCCCCGCGCCCGCCCGCGCCTCGTCTTCCGCACGCAGCTGGCGCACGGGAGCCCCACGGGCAAGATCGAGGGCTTCACCAACGTCCGCGAGCTGTACGCCAAGATCGCCGAAGCCTTCGGGATCGCGCCCACCGAGGTAAGGAGCCCGGACACCGGCGCCCAAGACCACCCGCCTGATGGGGTGAGGGGTAGGGAGCTTGGACCCTGGACGGGAGACCCCAGATCCCCGGATCCCAGACGTCGGGGTGGCCGCCTAATCGCCGGATCTCAGAGACCCAGCCCTCAGATCCCGGGGTGCCACACTCCCAGGGGCCCCCTTTGCACGCTCTGCGCAAAAGATGGGCAGGTCTTAGGACTAGCGGACCCCTAGATATTCCAGAAAATCCTCTGCGCAGACCTAGCTTGGAGCGGACCCCAGCCCTCGGGGAAGCGCCTCTGTGCTTCCTGGGCGTAGCTGGGGTCTGGGGTTCCAGATGGCCCCCTTAGGGATGGGAAGTTTGAGGCCGCCGTGGGGTTGGGGGGTTCCTGGGCGTTTTTCCAATCCGGGTTCGTTTGGTTTGCAGCCCCCAGGGGGCGCCAGCAGATTAAACCTGGAGGTCTGGGGGCTGGAGGTCCCGGGGTATGGAGAGGGGTCTCCACCTGCTGGAAGTCTCCTTCTCCCTCCTCTCTCTGTTCTGGGGGTCCCACGCCCTGCCCTTTCCCATGGGCTGGGATCCTGGTCGCTGGGGGCAGGGGCCTGCGCAGACAGGGTGGCTGCGTGGGGGGATGCATGCCCTGGCTAACTCTAGGCTCCTTCTCCCCCGGGAAGATTTTATTCTGCACCCTCAACAGCCACAAAGTGGACATGCAGAAGCTCCTGGGGGGTCAGATAGGCCTGGAGGACTTCATCTTTGCCCACGTGCGAGGCGAGACCAAGGAGGTGGAGGTCACTAAGACAGAGGATGCTCTGGGGCTGACCATCACGGACAACGGGGCTGGCTACGCCTTCATCAAGGTGCCCGGGAGGGGGTGGGCGGGTGGCTTCCTGGGGTCCAGCAACTGCCCCCCCCACTCTGGGTCGACGTGGGTTCTGCGGATTGGAGGCGGGTGGCTGGGGTTGCCCTGCCAGCGACGCTGGATCCCTGCAGAGAATCAAGGAAGGCAGTATCATCAACCGGATCGAGGCAGTGTGCGTGGGTGACAGCATCGAAGCCATCAACGACCACTCCATTGTGGGCTGCCGCCACTACGAGGTGGCCAAGATGCTCCGGGAGCTGCCCAAGTCCCAGCCCTTCACCCTGCGCCTGGTGCAGCCCAAGAGGGCCTTCG-C		Autosomal recessive nonsyndromic hearing loss 15	Likely pathogenic (Jul 01, 2021)
19-3585601-G-A		not specified • GIPC3-related disorder	Conflicting classifications of pathogenicity (Dec 11, 2023)
19-3585611-C-A		Inborn genetic diseases	Uncertain significance (Mar 11, 2022)
19-3585617-G-A		not specified • Inborn genetic diseases	Conflicting classifications of pathogenicity (Dec 20, 2023)
19-3585628-G-A			Uncertain significance (Jan 01, 2024)
19-3585647-C-G		not specified	Uncertain significance (Sep 01, 2022)
19-3585654-G-T		not specified • Autosomal recessive nonsyndromic hearing loss 15	Likely benign (Jan 10, 2024)
19-3585655-C-T			Uncertain significance (Mar 13, 2022)
19-3585663-C-T		not specified	Likely benign (Mar 01, 2024)
19-3585666-G-A		not specified • Autosomal recessive nonsyndromic hearing loss 15	Benign/Likely benign (Dec 26, 2023)
19-3585666-G-C		not specified	Likely benign (Nov 18, 2023)
19-3585672-G-T		not specified	Likely benign (Feb 13, 2019)
19-3585676-C-T			Uncertain significance (Mar 12, 2022)
19-3585678-C-G			Likely benign (Nov 29, 2022)
19-3585680-CG-C		Rare genetic deafness	Conflicting classifications of pathogenicity (Mar 01, 2024)
19-3585691-C-G			Uncertain significance (Jul 18, 2022)
19-3585691-C-T			Uncertain significance (Sep 26, 2021)
19-3585695-C-T			Uncertain significance (Jul 15, 2022)
19-3585700-C-G		Autosomal recessive nonsyndromic hearing loss 15	Uncertain significance (Nov 02, 2023)
19-3585711-C-G		GIPC3-related disorder	Likely benign (Jul 02, 2019)
19-3585716-GCA-G			Pathogenic (Feb 10, 2022)
19-3585719-C-A		Rare genetic deafness • Sensorineural hearing loss disorder	Conflicting classifications of pathogenicity (May 21, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GIPC3	protein_coding	protein_coding	ENST00000322315	6	7989

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.00934	0.944	125663	0	27	125690	0.000107

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.177	173	180	0.963	0.0000117	2007
Missense in Polyphen		60	66.514	0.90207		673
Synonymous	-0.0819	79	78.1	1.01	0.00000551	649
Loss of Function	1.73	5	11.3	0.444	5.72e-7	138

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000873	0.0000873
Ashkenazi Jewish	0.00	0.00
East Asian	0.000110	0.000109
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.000143	0.000141
Middle Eastern	0.000110	0.000109
South Asian	0.0000983	0.0000980
Other	0.000327	0.000326

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion. {ECO:0000250}.
• Disease: DISEASE: Deafness, autosomal recessive, 15 (DFNB15) [MIM:601869]: A form of non-syndromic sensorineural hearing loss with prelingual onset. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information. {ECO:0000269|PubMed:21326233, ECO:0000269|PubMed:21660509}. Note=The disease is caused by mutations affecting the gene represented in this entry.

Recessive Scores

• pRec: 0.130

Intolerance Scores

• loftool: 0.310
• rvis_EVS: -0.14
• rvis_percentile_EVS: 43.29

Haploinsufficiency Scores

• pHI: 0.243
• hipred: N
• hipred_score: 0.384
• ghis: 0.574

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.180

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gipc3
• Phenotype: behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); hearing/vestibular/ear phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan)