GJB1
Basic information
Region (hg38): X:71212810-71225516
Previous symbols: [ "CMTX1", "CMTX" ]
Links
Phenotypes
GenCC
Source:
- Charcot-Marie-Tooth disease X-linked dominant 1 (Moderate), mode of inheritance: XL
- Charcot-Marie-Tooth disease X-linked dominant 1 (Strong), mode of inheritance: XL
- X-linked progressive cerebellar ataxia (Supportive), mode of inheritance: XL
- Charcot-Marie-Tooth disease X-linked dominant 1 (Supportive), mode of inheritance: XL
- Charcot-Marie-Tooth disease X-linked dominant 1 (Definitive), mode of inheritance: XL
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Charcot-Marie-Tooth neuropathy, X-linked dominant, 1 | XL | General | Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing | Neurologic | 8266101; 10487913; 17100997; 17353473; 21254193; 21504505; 21692908; 21922480; 21692908; 22483671; 22577229 |
ClinVar
This is a list of variants' phenotypes submitted to
- Charcot-Marie-Tooth Neuropathy X (410 variants)
- Charcot-Marie-Tooth disease (173 variants)
- not provided (147 variants)
- Charcot-Marie-Tooth disease X-linked dominant 1 (122 variants)
- Inborn genetic diseases (43 variants)
- not specified (29 variants)
- Peripheral neuropathy (4 variants)
- GJB1-related condition (2 variants)
- Cerebellar ataxia (1 variants)
- D-2-hydroxyglutaric aciduria 1 (1 variants)
- GJB1-related disorders (1 variants)
- Charcot-Marie-Tooth disease-hearing loss-intellectual disability syndrome (1 variants)
- Pes cavus;Hammertoe;Distal muscle weakness;Decreased nerve conduction velocity;Sensory neuropathy (1 variants)
- Hand muscle atrophy;Peroneal muscle atrophy;Pes cavus;Distal lower limb muscle weakness (1 variants)
- Dejerine-Sottas disease (1 variants)
- 8 conditions (1 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the GJB1 gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 78 | 83 | ||||
missense | 47 | 77 | 164 | 292 | ||
nonsense | 20 | 23 | ||||
start loss | 4 | |||||
frameshift | 34 | 39 | ||||
inframe indel | 9 | |||||
splice donor/acceptor (+/-2bp) | 3 | |||||
splice region ? | 1 | 1 | 2 | |||
non coding ? | 10 | 20 | ||||
Total | 104 | 88 | 185 | 85 | 11 |
Highest pathogenic variant AF is 0.00000909
Variants in GJB1
This is a list of pathogenic ClinVar variants found in the GJB1 region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
X-71215290-G-C | Uncertain significance (Jan 01, 2018) | |||
X-71222995-G-A | not specified • Charcot-Marie-Tooth Neuropathy X | Benign (Jan 22, 2024) | ||
X-71223079-C-T | Likely benign (Oct 21, 2018) | |||
X-71223112-T-G | Uncertain significance (Dec 01, 2023) | |||
X-71223168-C-G | Charcot-Marie-Tooth Neuropathy X | Conflicting classifications of pathogenicity (Jun 02, 2023) | ||
X-71223169-AAAGG-CAAGT | Uncertain significance (May 15, 2017) | |||
X-71223179-T-C | Charcot-Marie-Tooth Neuropathy X | Pathogenic (Jan 04, 2024) | ||
X-71223179-T-G | Charcot-Marie-Tooth disease X-linked dominant 1 | Pathogenic (Nov 15, 2001) | ||
X-71223181-G-C | Charcot-Marie-Tooth disease X-linked dominant 1 | Pathogenic (Nov 01, 2004) | ||
X-71223181-G-T | Charcot-Marie-Tooth Neuropathy X | Uncertain significance (Aug 31, 2023) | ||
X-71223217-C-G | Charcot-Marie-Tooth disease X-linked dominant 1 | Uncertain significance (-) | ||
X-71223224-G-A | Charcot-Marie-Tooth disease X-linked dominant 1 | Uncertain significance (Jan 12, 2018) | ||
X-71223243-C-T | GJB1-related disorder | Likely benign (Jul 11, 2019) | ||
X-71223249-C-T | Charcot-Marie-Tooth disease X-linked dominant 1 • Charcot-Marie-Tooth Neuropathy X • Charcot-Marie-Tooth disease | Pathogenic/Likely pathogenic (Mar 15, 2024) | ||
X-71223250-G-A | Charcot-Marie-Tooth disease X-linked dominant 1 | Uncertain significance (Mar 30, 2018) | ||
X-71223251-C-T | not specified • GJB1-related disorder | Conflicting classifications of pathogenicity (Feb 28, 2023) | ||
X-71223275-G-A | not specified | Benign/Likely benign (Dec 22, 2016) | ||
X-71223307-G-T | Uncertain significance (Jul 15, 2022) | |||
X-71223325-C-T | not specified | Conflicting classifications of pathogenicity (Dec 12, 2017) | ||
X-71223335-G-A | Charcot-Marie-Tooth Neuropathy X • Charcot-Marie-Tooth disease X-linked dominant 1 | Pathogenic/Likely pathogenic (Jan 08, 2024) | ||
X-71223337-T-G | Charcot-Marie-Tooth Neuropathy X | Uncertain significance (Nov 05, 2023) | ||
X-71223345-C-A | Uncertain significance (Jul 01, 2020) | |||
X-71223451-C-T | not specified | Benign (Mar 01, 2016) | ||
X-71223610-G-C | Likely benign (Sep 01, 2018) | |||
X-71223642-CTTTCCACCCCAGCTTTCTGACAGCTTGCTTCATGGCTGGTGTTTTGCAGGTGTGAATGAGGCAGGATGAACTGGACAGGTTTGTACACCTTGCTCAGTGGCGTGAACCGGCATTCTACTGCCATTGGCCGAGTATGGCTCTCGGTCATCTTCATCTTCAGAATCATGGTGCTGGTGGTGGCTGCAGAGAGTGTGTGGGGTGATGAGAAATCTTCCTTCATCTGCAACACACTCCAGCCTGGCTGCAACAGCGTTTGCTATGACCAATTCTTCCCCATCTCCCATGTGCGGCTGTGGTCCCTGCAGCTCATCCTAG-C | Charcot-Marie-Tooth Neuropathy X | Pathogenic (Apr 19, 2023) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
GJB1 | protein_coding | protein_coding | ENST00000374022 | 1 | 10323 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
0.846 | 0.151 | 0 | 0 | 0 | 0 | 0.00 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 2.03 | 66 | 131 | 0.502 | 0.0000117 | 1828 |
Missense in Polyphen | 10 | 54.809 | 0.18245 | 839 | ||
Synonymous | 0.413 | 49 | 52.8 | 0.928 | 0.00000445 | 604 |
Loss of Function | 2.30 | 0 | 6.15 | 0.00 | 5.38e-7 | 82 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.00 | 0.00 |
Ashkenazi Jewish | 0.00 | 0.00 |
East Asian | 0.00 | 0.00 |
Finnish | 0.00 | 0.00 |
European (Non-Finnish) | 0.00 | 0.00 |
Middle Eastern | 0.00 | 0.00 |
South Asian | 0.00 | 0.00 |
Other | 0.00 | 0.00 |
dbNSFP
Source:
- Function
- FUNCTION: One gap junction consists of a cluster of closely packed pairs of transmembrane channels, the connexons, through which materials of low MW diffuse from one cell to a neighboring cell.;
- Disease
- DISEASE: Charcot-Marie-Tooth disease, X-linked dominant, 1 (CMTX1) [MIM:302800]: A form of Charcot-Marie-Tooth disease, a disorder of the peripheral nervous system, characterized by progressive weakness and atrophy, initially of the peroneal muscles and later of the distal muscles of the arms. Charcot-Marie-Tooth disease is classified in two main groups on the basis of electrophysiologic properties and histopathology: primary peripheral demyelinating neuropathies characterized by severely reduced motor nerve conduction velocities (NCVs) (less than 38m/s) and segmental demyelination and remyelination, and primary peripheral axonal neuropathies characterized by normal or mildly reduced NCVs and chronic axonal degeneration and regeneration on nerve biopsy. CMTX1 has both demyelinating and axonal features. Central nervous system involvement may occur. {ECO:0000269|PubMed:10071100, ECO:0000269|PubMed:10220155, ECO:0000269|PubMed:10234007, ECO:0000269|PubMed:10586284, ECO:0000269|PubMed:10732813, ECO:0000269|PubMed:10737979, ECO:0000269|PubMed:10873293, ECO:0000269|PubMed:10894999, ECO:0000269|PubMed:10923043, ECO:0000269|PubMed:10938190, ECO:0000269|PubMed:11030070, ECO:0000269|PubMed:11140841, ECO:0000269|PubMed:11180613, ECO:0000269|PubMed:11437164, ECO:0000269|PubMed:11438991, ECO:0000269|PubMed:11562788, ECO:0000269|PubMed:11571214, ECO:0000269|PubMed:11723288, ECO:0000269|PubMed:11835375, ECO:0000269|PubMed:11891346, ECO:0000269|PubMed:12185164, ECO:0000269|PubMed:12207932, ECO:0000269|PubMed:12325071, ECO:0000269|PubMed:12402337, ECO:0000269|PubMed:12477701, ECO:0000269|PubMed:12497641, ECO:0000269|PubMed:12536289, ECO:0000269|PubMed:12707076, ECO:0000269|PubMed:14627639, ECO:0000269|PubMed:15241803, ECO:0000269|PubMed:15468313, ECO:0000269|PubMed:15852376, ECO:0000269|PubMed:27234031, ECO:0000269|PubMed:7477983, ECO:0000269|PubMed:7833935, ECO:0000269|PubMed:8004109, ECO:0000269|PubMed:8162049, ECO:0000269|PubMed:8266101, ECO:0000269|PubMed:8628473, ECO:0000269|PubMed:8698335, ECO:0000269|PubMed:8733054, ECO:0000269|PubMed:8737658, ECO:0000269|PubMed:8807343, ECO:0000269|PubMed:8829637, ECO:0000269|PubMed:8889588, ECO:0000269|PubMed:8956046, ECO:0000269|PubMed:8990008, ECO:0000269|PubMed:9018031, ECO:0000269|PubMed:9099841, ECO:0000269|PubMed:9187667, ECO:0000269|PubMed:9272161, ECO:0000269|PubMed:9361298, ECO:0000269|PubMed:9452025, ECO:0000269|PubMed:9452099, ECO:0000269|PubMed:9469569, ECO:0000269|PubMed:9633821, ECO:0000269|PubMed:9818870, ECO:0000269|PubMed:9856562, ECO:0000269|Ref.12}. Note=The disease is caused by mutations affecting the gene represented in this entry.; DISEASE: Dejerine-Sottas syndrome (DSS) [MIM:145900]: A severe degenerating neuropathy of the demyelinating Charcot-Marie-Tooth disease category, with onset by age 2 years. Characterized by motor and sensory neuropathy with very slow nerve conduction velocities, increased cerebrospinal fluid protein concentrations, hypertrophic nerve changes, delayed age of walking as well as areflexia. There are both autosomal dominant and autosomal recessive forms of Dejerine-Sottas syndrome. {ECO:0000269|PubMed:15947997}. Note=The gene represented in this entry may act as a disease modifier.;
- Pathway
- Neural Crest Differentiation;Common Pathways Underlying Drug Addiction;Calcium Regulation in the Cardiac Cell;Vesicle-mediated transport;Membrane Trafficking;Transport of connexins along the secretory pathway;Oligomerization of connexins into connexons;Gap junction assembly;Gap junction trafficking;Gap junction trafficking and regulation
(Consensus)
Recessive Scores
- pRec
- 0.440
Intolerance Scores
- loftool
- rvis_EVS
- 0.21
- rvis_percentile_EVS
- 67.72
Haploinsufficiency Scores
- pHI
- 0.824
- hipred
- Y
- hipred_score
- 0.642
- ghis
- 0.409
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.801
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Gjb1
- Phenotype
- homeostasis/metabolism phenotype; cellular phenotype; growth/size/body region phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan); liver/biliary system phenotype; immune system phenotype; nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); vision/eye phenotype; hematopoietic system phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span);
Gene ontology
- Biological process
- cell-cell signaling;nervous system development;purine ribonucleotide transport;gap junction assembly;protein complex oligomerization;transmembrane transport;epididymis development
- Cellular component
- endoplasmic reticulum membrane;connexin complex;integral component of membrane;lateral plasma membrane
- Molecular function
- gap junction channel activity;protein homodimerization activity