GJB4

gap junction protein beta 4, the group of Gap junction proteins

Basic information

Region (hg38): 1:34759739-34762327

Links

ENSG00000189433 ∙ NCBI:127534 ∙ OMIM:605425 ∙ HGNC:4286 ∙ Uniprot:Q9NTQ9 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• erythrokeratodermia variabilis et progressiva 2 (Strong), mode of inheritance: AD
• erythrokeratodermia variabilis et progressiva 2 (Limited), mode of inheritance: AR
• erythrokeratodermia variabilis (Supportive), mode of inheritance: AD
• erythrokeratodermia variabilis et progressiva 2 (Strong), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Erythrokeratodermia variabilis et progressiva 2	AD	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Dermatologic	148984; 11017804; 12648223; 19291775; 21564177; 22266302; 23037955

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GJB4 gene.

• not provided (54 variants)
• Inborn genetic diseases (17 variants)
• Erythrokeratodermia variabilis et progressiva 2 (8 variants)
• not specified (6 variants)
• Autosomal recessive nonsyndromic hearing loss 1A;Autosomal dominant nonsyndromic hearing loss 3A (1 variants)
• Erythrokeratodermia variabilis et progressiva 1 (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GJB4 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				7	10	17
missense	1	1	29	2	8	41
nonsense				1		1
start loss						0
frameshift				1	1	2
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding					3	3
Total	1	1	29	11	22

Variants in GJB4

This is a list of pathogenic ClinVar variants found in the GJB4 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
1-34760655-T-C			Benign (Nov 12, 2018)
1-34761254-CA-C		Erythrokeratodermia variabilis et progressiva 2	Uncertain significance (Mar 25, 2024)
1-34761261-T-C		Inborn genetic diseases	Uncertain significance (Aug 04, 2023)
1-34761289-G-A		Erythrokeratodermia variabilis et progressiva 2	Pathogenic (Apr 01, 2003)
1-34761291-G-A			Likely benign (Dec 21, 2021)
1-34761300-TACTCCACAGTGCTGAGCCGCATCTGGCTGTCTGTGGTGTTCATCTTTCGTGTGCTGGTGTACGTGGTGGCAGCGGAGGAGGTGTGGGACGATGAGCAGAAGG-T			Uncertain significance (Nov 07, 2022)
1-34761316-G-A		Inborn genetic diseases	Uncertain significance (Jun 22, 2021)
1-34761319-G-A		Erythrokeratodermia variabilis et progressiva 2	Uncertain significance (Jan 31, 2022)
1-34761323-C-G		Inborn genetic diseases	Uncertain significance (Jun 29, 2022)
1-34761343-T-C		Inborn genetic diseases	Uncertain significance (Mar 17, 2023)
1-34761348-C-T			Uncertain significance (Jun 14, 2023)
1-34761352-T-C			Uncertain significance (Oct 05, 2022)
1-34761362-C-T			Benign (Jul 17, 2023)
1-34761363-G-A		Autosomal recessive nonsyndromic hearing loss 1A;Autosomal dominant nonsyndromic hearing loss 3A	Conflicting classifications of pathogenicity (Jun 26, 2022)
1-34761374-G-A			Likely benign (Apr 01, 2023)
1-34761375-G-A		Erythrokeratodermia variabilis et progressiva 2	Uncertain significance (Jul 03, 2023)
1-34761382-T-C			Uncertain significance (Nov 27, 2023)
1-34761392-T-C			Benign (Oct 11, 2023)
1-34761393-G-A		Inborn genetic diseases	Uncertain significance (Nov 22, 2021)
1-34761404-CT-C		not specified • Erythrokeratodermia variabilis et progressiva 2	Benign/Likely benign (Dec 24, 2023)
1-34761406-TTGTC-T			Benign (Jan 24, 2024)
1-34761408-G-A			Uncertain significance (Sep 28, 2022)
1-34761432-T-G		Inborn genetic diseases • Erythrokeratodermia variabilis et progressiva 2	Conflicting classifications of pathogenicity (Sep 19, 2023)
1-34761437-C-A		GJB4-related disorder	Benign (Jan 18, 2024)
1-34761440-C-T			Benign (Nov 13, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GJB4	protein_coding	protein_coding	ENST00000339480	1	3984

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000551	0.481	116232	200	9316	125748	0.0386

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	-0.637	193	170	1.14	0.0000125	1720
Missense in Polyphen		79	64.648	1.222		722
Synonymous	-1.57	94	76.5	1.23	0.00000583	558
Loss of Function	0.195	5	5.49	0.910	2.44e-7	67

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.114	0.0826
Ashkenazi Jewish	0.0180	0.0181
East Asian	0.000435	0.000435
Finnish	0.0551	0.0557
European (Non-Finnish)	0.0487	0.0485
Middle Eastern	0.000435	0.000435
South Asian	0.0318	0.0312
Other	0.0378	0.0363

dbNSFP

Source: dbNSFP

• Function: FUNCTION: One gap junction consists of a cluster of closely packed pairs of transmembrane channels, the connexons, through which materials of low MW diffuse from one cell to a neighboring cell.
• Disease: DISEASE: Erythrokeratodermia variabilis et progressiva 2 (EKVP2) [MIM:617524]: A form of erythrokeratodermia variabilis et progressiva, a genodermatosis characterized by the coexistence of two independent skin lesions: transient erythema and hyperkeratosis that is usually localized but occasionally occurs in its generalized form. Clinical presentation varies significantly within a family and from one family to another. Palmoplantar keratoderma is present in around 50% of cases. {ECO:0000269|PubMed:11017804, ECO:0000269|PubMed:12648223, ECO:0000269|PubMed:19291775}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Calcium Regulation in the Cardiac Cell (Consensus)

Recessive Scores

• pRec: 0.111

Intolerance Scores

• loftool: 0.141
• rvis_EVS: 0.64
• rvis_percentile_EVS: 84.1

Haploinsufficiency Scores

• pHI: 0.187
• hipred: N
• hipred_score: 0.170
• ghis: 0.524

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: N
• gene_indispensability_score: 0.224

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gjb4
• Phenotype: reproductive system phenotype; taste/olfaction phenotype

Gene ontology

• Biological process: cell communication;sensory perception of smell;olfactory behavior
• Cellular component: nucleus;nucleolus;connexin complex;integral component of membrane;cell junction