GLS

glutaminase, the group of Ankyrin repeat domain containing

Basic information

Region (hg38): 2:190880820-190965552

Links

ENSG00000115419 ∙ NCBI:2744 ∙ OMIM:138280 ∙ HGNC:4331 ∙ Uniprot:O94925 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• developmental and epileptic encephalopathy, 71 (Limited), mode of inheritance: AR
• global developmental delay, progressive ataxia, and elevated glutamine (Strong), mode of inheritance: AR
• infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development (Limited), mode of inheritance: Unknown
• glutaminase deficiency (Moderate), mode of inheritance: AR
• infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development (Moderate), mode of inheritance: AD
• glutaminase deficiency (Definitive), mode of inheritance: AR
• infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development (Limited), mode of inheritance: AD

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development; Epileptic encephalopathy, early infantile, 71; Global developmental delay, progressive ataxia, and elevated glutamine	AD/AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Biochemical; Dermatologic; Neurologic; Ophthalmologic	30239721; 30575854; 30970188
Global developmental delay, progressive ataxia, and elevated glutamine is caused by triplet repeat expansion upstream of the GLS gene

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GLS gene.

• not provided (18 variants)
• Inborn genetic diseases (16 variants)
• Developmental and epileptic encephalopathy, 71 (7 variants)
• GLS-related condition (2 variants)
• Infantile cataract, skin abnormalities, glutamate excess, and impaired intellectual development (1 variants)
• Global developmental delay, progressive ataxia, and elevated glutamine (1 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GLS gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				2	1	3
missense	1	2	30		1	34
nonsense	1					1
start loss						0
frameshift	2	1				3
inframe indel			1			1
splice donor/acceptor (+/-2bp)		1				1
splice region						0
non coding					1	1
Total	4	4	31	2	3

Variants in GLS

This is a list of pathogenic ClinVar variants found in the GLS region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-190880872-CGCAGCAGCA-C		GLS-related disorder	Likely benign (Sep 27, 2021)
2-190880872-CGCAGCAGCAGCA-C		GLS-related disorder	Likely benign (Sep 30, 2021)
2-190880872-CGCAGCAGCAGCAGCA-C		GLS-related disorder	Likely benign (Apr 15, 2021)
2-190880872-CGCAGCAGCAGCAGCAGCAGCA-C		GLS-related disorder	Likely benign (Nov 17, 2022)
2-190880872-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-C		GLS-related disorder	Likely benign (Feb 14, 2024)
2-190880872-C-CGCAGCAGCA		GLS-related disorder	Likely benign (May 13, 2021)
2-190880872-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		Global developmental delay, progressive ataxia, and elevated glutamine	Pathogenic (Nov 25, 2020)
2-190880872-C-CGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA		GLS-related disorder	Likely benign (Sep 30, 2021)
2-190880872-C-CGCAGCAGCAGCAGCAGCAGCAGCA		GLS-related disorder	Likely benign (Nov 01, 2021)
2-190880872-C-CGCAGCAGCAGCAGCAGCAGCA		GLS-related disorder	Likely benign (Nov 01, 2021)
2-190880872-C-CGCAGCAGCAGCAGCA			Benign (Nov 01, 2023)
2-190881091-C-T		Developmental and epileptic encephalopathy, 71	Uncertain significance (Sep 02, 2022)
2-190881120-C-A		Inborn genetic diseases	Uncertain significance (Feb 28, 2024)
2-190881150-C-G		Inborn genetic diseases	Uncertain significance (Jan 10, 2023)
2-190881158-T-G		Inborn genetic diseases	Uncertain significance (May 31, 2023)
2-190881163-C-G		Inborn genetic diseases	Uncertain significance (Aug 09, 2021)
2-190881208-G-A		Inborn genetic diseases	Uncertain significance (Dec 21, 2022)
2-190881209-G-A		GLS-related disorder	Likely benign (Oct 18, 2023)
2-190881209-G-T			Uncertain significance (Nov 07, 2019)
2-190881232-G-A		Inborn genetic diseases	Uncertain significance (Dec 16, 2023)
2-190881233-C-A		Inborn genetic diseases	Uncertain significance (Nov 15, 2021)
2-190881273-G-T		Global developmental delay, progressive ataxia, and elevated glutamine	Uncertain significance (-)
2-190881278-C-T		Inborn genetic diseases	Uncertain significance (Jul 15, 2021)
2-190881281-A-G		Inborn genetic diseases	Likely benign (Nov 14, 2023)
2-190881301-T-C			Uncertain significance (Sep 01, 2023)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GLS	protein_coding	protein_coding	ENST00000320717	18	84726

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.962	0.0385	125721	0	14	125735	0.0000557

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	3.73	133	321	0.414	0.0000151	4330
Missense in Polyphen		16	86.415	0.18515		1095
Synonymous	0.919	102	115	0.891	0.00000557	1292
Loss of Function	4.69	6	36.6	0.164	0.00000209	445

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.00	0.00
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.0000926	0.0000924
European (Non-Finnish)	0.0000891	0.0000879
Middle Eastern	0.00	0.00
South Asian	0.0000654	0.0000653
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Catalyzes the first reaction in the primary pathway for the renal catabolism of glutamine. Plays a role in maintaining acid-base homeostasis. Regulates the levels of the neurotransmitter glutamate in the brain. Isoform 2 lacks catalytic activity.
• Pathway: Alanine, aspartate and glutamate metabolism - Homo sapiens (human);Central carbon metabolism in cancer - Homo sapiens (human);GABAergic synapse - Homo sapiens (human);Glutamatergic synapse - Homo sapiens (human);D-Glutamine and D-glutamate metabolism - Homo sapiens (human);Proximal tubule bicarbonate reclamation - Homo sapiens (human);MicroRNAs in cancer - Homo sapiens (human);Arginine biosynthesis - Homo sapiens (human);Amino Acid metabolism;Gene expression (Transcription);Generic Transcription Pathway;Glutamate Glutamine metabolism;Metabolism of amino acids and derivatives;RNA Polymerase II Transcription;Metabolism;glutamine degradation/glutamate biosynthesis;Neuronal System;TP53 Regulates Metabolic Genes;Urea cycle and metabolism of arginine, proline, glutamate, aspartate and asparagine;Glutamate Neurotransmitter Release Cycle;Neurotransmitter release cycle;Transcriptional Regulation by TP53;Transmission across Chemical Synapses;Amino acid synthesis and interconversion (transamination) (Consensus)

Intolerance Scores

• loftool: 0.369
• rvis_EVS: 0.15
• rvis_percentile_EVS: 64.32

Haploinsufficiency Scores

• pHI: 0.134
• hipred: Y
• hipred_score: 0.728
• ghis: 0.516

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: S
• essential_gene_gene_trap: K
• gene_indispensability_pred: E
• gene_indispensability_score: 0.950

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gls
• Phenotype: normal phenotype; mortality/aging (the observable characteristics related to the ability of a mammalian organism to live and age that are manifested throughout development and life span); nervous system phenotype (the observable morphological and physiological characteristics of the extensive, intricate network of electochemical structures in the body that is comprised of the brain, spinal cord, nerves, ganglia and parts of the receptor organs that are manifested through development and lifespan); respiratory system phenotype; behavior/neurological phenotype (the observable actions or reactions of mammalian organisms that are manifested through development and lifespan)

Gene ontology

• Biological process: suckling behavior;regulation of respiratory gaseous exchange by neurological system process;glutamate biosynthetic process;glutamine catabolic process;chemical synaptic transmission;cellular amino acid biosynthetic process;glutamate secretion;protein homotetramerization
• Cellular component: mitochondrion;mitochondrial matrix;cytosol
• Molecular function: glutaminase activity;protein binding