GPR68

G protein-coupled receptor 68, the group of G protein-coupled receptors, Class A orphans

Basic information

Region (hg38): 14:91232532-91253925

Links

ENSG00000119714 ∙ NCBI:8111 ∙ OMIM:601404 ∙ HGNC:4519 ∙ Uniprot:Q15743 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• amelogenesis imperfecta type 2 (Supportive), mode of inheritance: AR
• amelogenesis imperfecta, hypomaturation type, IIa6 (Strong), mode of inheritance: AR
• amelogenesis imperfecta, hypomaturation type, IIa6 (Limited), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Amelogenesis imperfecta, hypomaturation type, IIA6	AR	General	Genetic knowledge may be beneficial related to issues such as selection of optimal supportive care, informed medical decision-making, prognostic considerations, and avoidance of unnecessary testing	Dental	27693231

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the GPR68 gene.

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the GPR68 gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous				8	2	10
missense			20	2		22
nonsense				1		1
start loss						0
frameshift			1			1
inframe indel						0
splice donor/acceptor (+/-2bp)						0
splice region						0
non coding					5	5
Total	0	0	21	11	7

Variants in GPR68

This is a list of pathogenic ClinVar variants found in the GPR68 region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
14-91233988-C-G		not specified	Uncertain significance (Jan 07, 2022)
14-91234045-C-A			Likely benign (Dec 31, 2019)
14-91234057-C-T		not specified	Uncertain significance (Mar 29, 2023)
14-91234061-T-A			Likely benign (Dec 31, 2019)
14-91234075-C-CG		Amelogenesis imperfecta, hypomaturation type, IIa6	Uncertain significance (Mar 31, 2022)
14-91234083-C-T		not specified	Uncertain significance (Apr 01, 2024)
14-91234111-C-T		not specified	Likely benign (Mar 02, 2023)
14-91234181-G-A		GPR68-related disorder	Likely benign (Mar 09, 2020)
14-91234192-A-C		not specified	Uncertain significance (May 31, 2023)
14-91234208-G-C		GPR68-related disorder	Likely benign (Mar 21, 2019)
14-91234215-CAGTTGAAGCTGGTGAGCAGGAGGGAGAAGTGGTAGGCGTTGAAAACGCCCTTGGCGAAGTCGCAGCTGGCCTCCCAGACGCTGCGCACCAGCAGCAACACGTGGTAGGGCAGGAAGCAGGCCAGGAAGATGACCACGGTGCTGAGCACCAGCCGCTGGATCTGGTCCTTGCGGCTCTTCTGGGTGCCGTGGCTCCGGCGCACGGCGCGCAGGATGCCCTGGTAGGACGCCAGCAGCAGGCAGATGGGGAAGAGGAAGCCCACCAGGAAGCGGTAGTAGTTGATGGCGCGCTGCCATGCCTGGATGGGGTAGTGCTCAAAGCACACGCGGTGCTGGTTCTCGTCCTCGATGACCTCCTCGTGCATCAGGAAGTAGATGCTGGTCAGCAGCTCCTTGGCCCAGATGACCACGCTGACGCCGACGGCCGCCTTCAGGGTCCGGAACTGGTGGA-C		Amelogenesis imperfecta, hypomaturation type, IIa6 • Amelogenesis imperfecta	Pathogenic (Nov 21, 2016)
14-91234261-C-T		not specified	Likely benign (Apr 09, 2024)
14-91234276-C-T		not specified	Uncertain significance (Mar 28, 2023)
14-91234353-G-C		not specified	Uncertain significance (Sep 13, 2023)
14-91234368-C-T		not specified	Uncertain significance (Feb 10, 2022)
14-91234382-CTT-C		Amelogenesis imperfecta, hypomaturation type, IIa6 • Amelogenesis imperfecta	Pathogenic (Nov 21, 2016)
14-91234394-C-G		not specified	Uncertain significance (Oct 06, 2021)
14-91234435-G-C		not specified	Uncertain significance (Nov 14, 2023)
14-91234437-T-G		not specified	Uncertain significance (Jan 08, 2024)
14-91234502-G-A			Benign (Jun 09, 2021)
14-91234528-G-A		not specified	Uncertain significance (Jan 03, 2024)
14-91234531-C-G		not specified	Uncertain significance (Jan 23, 2024)
14-91234544-G-C		not specified	Uncertain significance (Apr 12, 2023)
14-91234555-C-T		not specified	Uncertain significance (Jun 11, 2021)
14-91234584-A-T		not specified	Uncertain significance (Jan 03, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
GPR68	protein_coding	protein_coding	ENST00000531499	1	21394

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.000500	0.699	125700	0	16	125716	0.0000636

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.19	173	223	0.775	0.0000152	2317
Missense in Polyphen		40	67.9	0.5891		709
Synonymous	-0.262	117	113	1.03	0.00000890	757
Loss of Function	0.832	6	8.64	0.694	3.71e-7	87

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000213	0.000210
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.0000892	0.0000879
Middle Eastern	0.00	0.00
South Asian	0.0000359	0.0000327
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Proton-sensing receptor involved in pH homeostasis. May represents an osteoblastic pH sensor regulating cell-mediated responses to acidosis in bone. Mediates its action by association with G proteins that stimulates inositol phosphate (IP) production or Ca(2+) mobilization. The receptor is almost silent at pH 7.8 but fully activated at pH 6.8. Function also as a metastasis suppressor gene in prostate cancer (By similarity). {ECO:0000250, ECO:0000269|PubMed:12955148}.
• Pathway: Osteoclast Signaling;GPCRs, Class A Rhodopsin-like;Signaling by GPCR;Signal Transduction;Class A/1 (Rhodopsin-like receptors);GPCR ligand binding;G alpha (q) signalling events;GPCR downstream signalling (Consensus)

Recessive Scores

• pRec: 0.120

Intolerance Scores

• loftool: 0.461
• rvis_EVS: -0.6
• rvis_percentile_EVS: 17.91

Haploinsufficiency Scores

• pHI: 0.239
• hipred: N
• hipred_score: 0.495
• ghis: 0.582

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.630

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Gpr68
• Phenotype: neoplasm; hematopoietic system phenotype; skeleton phenotype; renal/urinary system phenotype; immune system phenotype; adipose tissue phenotype (the observable morphological and physiological characteristics of mammalian fat tissue that are manifested through development and lifespan); endocrine/exocrine gland phenotype; cellular phenotype; homeostasis/metabolism phenotype

Gene ontology

• Biological process: inflammatory response;G protein-coupled receptor signaling pathway;positive regulation of insulin secretion involved in cellular response to glucose stimulus;negative regulation of monocyte differentiation;cellular response to pH;positive regulation of osteoclast development
• Cellular component: plasma membrane;integral component of plasma membrane
• Molecular function: G protein-coupled receptor activity