HGD

homogentisate 1,2-dioxygenase

Basic information

Region (hg38): 3:120628172-120682269

Previous symbols: [ "AKU" ]

Links

ENSG00000113924 ∙ NCBI:3081 ∙ OMIM:607474 ∙ HGNC:4892 ∙ Uniprot:Q93099 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• alkaptonuria (Strong), mode of inheritance: AR
• alkaptonuria (Supportive), mode of inheritance: AR
• alkaptonuria (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Alkaptonuria	AR	Biochemical; Cardiovascular; Musculoskeletal; Renal	The condition can include cardiac complications, and surveillance for early detection and management of manifestations such as aortic dilatation, valvular disease, or coronary artery calcification may be beneficial; Awareness of complications including urolithiasis and joint degeneration may allow prompt recognition and treatment; Other, more specific therapies are under investigation	Biochemical; Cardiovascular; Musculoskeletal; Renal	12784973; 5472968; 2667832; 2771520; 2270175; 2316305; 8782815; 9154114; 9529363; 9809834; 10482952; 10594001; 11001939; 10970188; 10945668; 12359141; 12501223; 12872815; 15260431; 20301627; 21620748; 21927854; 22482092; 22772574; 23035044; 23357094; 23353776; 23430897; 23430917; 23438536; 23466771; 23486607; 23619548; 23879342; 24009934; 24009959

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the HGD gene.

• Alkaptonuria (49 variants)
• not provided (4 variants)
• HGD-related disorder (4 variants)
• See cases (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the HGD gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous		1	2	93	2	98
missense	10	35	85	5	2	137
nonsense	8	17	1			26
start loss	1	1				2
frameshift	20	21				41
inframe indel			1			1
splice donor/acceptor (+/-2bp)	9	16				25
splice region		1	8	18	4	31
non coding	1		10	53	5	69
Total	49	91	99	151	9

Highest pathogenic variant AF is 0.000335

Variants in HGD

This is a list of pathogenic ClinVar variants found in the HGD region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
3-120628225-T-C		Alkaptonuria	Uncertain significance (Apr 27, 2017)
3-120628235-G-A		Alkaptonuria	Uncertain significance (Jan 13, 2018)
3-120628263-C-T		Alkaptonuria	Uncertain significance (Jan 13, 2018)
3-120628348-C-T		Alkaptonuria	Uncertain significance (Jan 12, 2018)
3-120628382-A-G		Alkaptonuria	Conflicting classifications of pathogenicity (May 30, 2024)
3-120628383-A-G		Alkaptonuria	Likely benign (Oct 18, 2023)
3-120628386-A-G		Alkaptonuria	Likely benign (Sep 09, 2022)
3-120628393-G-T		Alkaptonuria	Uncertain significance (Mar 14, 2024)
3-120628398-G-A		Alkaptonuria	Likely benign (Jul 07, 2023)
3-120628404-G-A		Alkaptonuria	Likely benign (Jul 22, 2022)
3-120628413-A-G		Alkaptonuria	Likely benign (Feb 05, 2023)
3-120628417-AAGTGGCTCTTG-A		Alkaptonuria	Conflicting classifications of pathogenicity (Jun 27, 2022)
3-120628419-G-A		Alkaptonuria	Likely benign (Feb 02, 2020)
3-120628428-G-A		Alkaptonuria	Likely benign (Apr 04, 2022)
3-120628429-AG-A		Alkaptonuria	Pathogenic (Aug 06, 2020)
3-120628430-G-T			Uncertain significance (Sep 16, 2018)
3-120628431-T-A		Alkaptonuria	Likely benign (Jun 11, 2021)
3-120628437-C-T		Alkaptonuria	Uncertain significance (-)
3-120628443-C-T		Alkaptonuria	Likely benign (Jul 25, 2023)
3-120628449-G-T		Alkaptonuria	Pathogenic (Jul 08, 2021)
3-120628452-G-A		Alkaptonuria	Conflicting classifications of pathogenicity (Mar 03, 2024)
3-120628456-TCATC-T		Alkaptonuria	Likely pathogenic (Mar 26, 2024)
3-120628465-C-T		Inborn genetic diseases	Uncertain significance (Jul 06, 2021)
3-120628469-T-G		Alkaptonuria	Likely benign (Jan 21, 2024)
3-120628469-TGGAGGCCTTGAGTCCCCACTTTGTGACCGCCAGACTTAAAGATGATTCAAACATAAATGCCTGGAGGAAGTGACGATGGGGATGAGAAAAAAGAGGTGAGA-T		Alkaptonuria	Pathogenic (-)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
HGD	protein_coding	protein_coding	ENST00000283871	14	54399

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
2.96e-8	0.921	125664	0	82	125746	0.000326

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	0.290	223	236	0.947	0.0000125	2948
Missense in Polyphen		99	100.66	0.98353		1220
Synonymous	-1.86	106	84.3	1.26	0.00000463	820
Loss of Function	1.81	16	26.0	0.616	0.00000129	316

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.000235	0.000235
Ashkenazi Jewish	0.00	0.00
East Asian	0.000272	0.000272
Finnish	0.0000462	0.0000462
European (Non-Finnish)	0.000353	0.000352
Middle Eastern	0.000272	0.000272
South Asian	0.000915	0.000915
Other	0.000163	0.000163

dbNSFP

Source: dbNSFP

• Pathway: Tyrosine metabolism - Homo sapiens (human);Tyrosinemia, transient, of the newborn;Dopamine beta-hydroxylase deficiency;Disulfiram Action Pathway;Phenylalanine and Tyrosine Metabolism;Tyrosine Metabolism;Alkaptonuria;Monoamine oxidase-a deficiency (MAO-A);Hawkinsinuria;Tyrosinemia Type I;Phenylketonuria;Tyrosinemia Type 3 (TYRO3);Tyrosinemia Type 2 (or Richner-Hanhart syndrome);Histidine, lysine, phenylalanine, tyrosine, proline and tryptophan catabolism;Metabolism of amino acids and derivatives;Phenylalanine and tyrosine catabolism;Metabolism;tyrosine degradation;Tyrosine metabolism (Consensus)

Recessive Scores

• pRec: 0.235

Intolerance Scores

• loftool: 0.273
• rvis_EVS: -0.38
• rvis_percentile_EVS: 28.01

Haploinsufficiency Scores

• pHI: 0.591
• hipred: N
• hipred_score: 0.394
• ghis: 0.549

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.990

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Hgd
• Phenotype: immune system phenotype; renal/urinary system phenotype; liver/biliary system phenotype; homeostasis/metabolism phenotype; growth/size/body region phenotype

Gene ontology

• Biological process: cellular amino acid metabolic process;L-phenylalanine catabolic process;tyrosine catabolic process;oxidation-reduction process
• Cellular component: cytosol;extracellular exosome
• Molecular function: homogentisate 1,2-dioxygenase activity;protein binding;identical protein binding;metal ion binding