HGD
Basic information
Region (hg38): 3:120628171-120682269
Previous symbols: [ "AKU" ]
Links
Phenotypes
GenCC
Source:
- alkaptonuria (Strong), mode of inheritance: AR
- alkaptonuria (Supportive), mode of inheritance: AR
- alkaptonuria (Definitive), mode of inheritance: AR
Clinical Genomic Database
Source:
Condition | Inheritance | Intervention Categories | Intervention/Rationale | Manifestation Categories | References |
---|---|---|---|---|---|
Alkaptonuria | AR | Biochemical; Cardiovascular; Musculoskeletal; Renal | The condition can include cardiac complications, and surveillance for early detection and management of manifestations such as aortic dilatation, valvular disease, or coronary artery calcification may be beneficial; Awareness of complications including urolithiasis and joint degeneration may allow prompt recognition and treatment; Other, more specific therapies are under investigation | Biochemical; Cardiovascular; Musculoskeletal; Renal | 12784973; 5472968; 2667832; 2771520; 2270175; 2316305; 8782815; 9154114; 9529363; 9809834; 10482952; 10594001; 11001939; 10970188; 10945668; 12359141; 12501223; 12872815; 15260431; 20301627; 21620748; 21927854; 22482092; 22772574; 23035044; 23357094; 23353776; 23430897; 23430917; 23438536; 23466771; 23486607; 23619548; 23879342; 24009934; 24009959 |
ClinVar
This is a list of variants' phenotypes submitted to
- Alkaptonuria (304 variants)
- not provided (10 variants)
- Inborn genetic diseases (7 variants)
- not specified (5 variants)
- HGD-related condition (2 variants)
- Intervertebral disk calcification (2 variants)
Variants pathogenicity by type
Statistics on ClinVar variants can assist in determining whether a specific variant type in the HGD gene is commonly pathogenic or not.
In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.
Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.
Variant type | Pathogenic | Likely pathogenic | VUS | Likely benign | Benign | Sum |
---|---|---|---|---|---|---|
synonymous | 70 | 75 | ||||
missense | 11 | 26 | 39 | 83 | ||
nonsense | 16 | |||||
start loss | 2 | |||||
frameshift | 19 | 17 | 36 | |||
inframe indel | 1 | |||||
splice donor/acceptor (+/-2bp) | 14 | 22 | ||||
splice region ? | 4 | 16 | 3 | 23 | ||
non coding ? | 24 | 39 | ||||
Total | 48 | 66 | 52 | 99 | 9 |
Highest pathogenic variant AF is 0.000335
Variants in HGD
This is a list of pathogenic ClinVar variants found in the HGD region.
You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.
Position | Type | Phenotype | Significance | ClinVar |
---|---|---|---|---|
3-120628225-T-C | Alkaptonuria | Uncertain significance (Apr 27, 2017) | ||
3-120628235-G-A | Alkaptonuria | Uncertain significance (Jan 13, 2018) | ||
3-120628263-C-T | Alkaptonuria | Uncertain significance (Jan 13, 2018) | ||
3-120628348-C-T | Alkaptonuria | Uncertain significance (Jan 12, 2018) | ||
3-120628382-A-G | Alkaptonuria | Conflicting classifications of pathogenicity (Oct 31, 2022) | ||
3-120628383-A-G | Alkaptonuria | Likely benign (Oct 18, 2023) | ||
3-120628386-A-G | Alkaptonuria | Likely benign (Sep 09, 2022) | ||
3-120628398-G-A | Alkaptonuria | Likely benign (Jul 07, 2023) | ||
3-120628404-G-A | Alkaptonuria | Likely benign (Jul 22, 2022) | ||
3-120628413-A-G | Alkaptonuria | Likely benign (Feb 05, 2023) | ||
3-120628417-AAGTGGCTCTTG-A | Alkaptonuria | Conflicting classifications of pathogenicity (Jun 27, 2022) | ||
3-120628419-G-A | Alkaptonuria | Likely benign (Feb 02, 2020) | ||
3-120628428-G-A | Alkaptonuria | Likely benign (Apr 04, 2022) | ||
3-120628429-AG-A | Alkaptonuria | Pathogenic (Aug 06, 2020) | ||
3-120628430-G-T | Uncertain significance (Sep 16, 2018) | |||
3-120628431-T-A | Alkaptonuria | Likely benign (Jun 11, 2021) | ||
3-120628437-C-T | Alkaptonuria | Uncertain significance (-) | ||
3-120628443-C-T | Alkaptonuria | Likely benign (Jul 25, 2023) | ||
3-120628449-G-T | Alkaptonuria | Pathogenic (Jul 08, 2021) | ||
3-120628452-G-A | Alkaptonuria | Uncertain significance (Jan 13, 2018) | ||
3-120628465-C-T | Inborn genetic diseases | Uncertain significance (Jul 06, 2021) | ||
3-120628469-T-G | Alkaptonuria | Likely benign (Jan 21, 2024) | ||
3-120628469-TGGAGGCCTTGAGTCCCCACTTTGTGACCGCCAGACTTAAAGATGATTCAAACATAAATGCCTGGAGGAAGTGACGATGGGGATGAGAAAAAAGAGGTGAGA-T | Alkaptonuria | Pathogenic (-) | ||
3-120628470-G-A | Alkaptonuria | Likely benign (Feb 03, 2022) | ||
3-120628472-AG-A | Alkaptonuria | Pathogenic (Apr 12, 2021) |
GnomAD
Source:
Gene | Type | Bio Type | Transcript | Coding Exons | Length |
---|---|---|---|---|---|
HGD | protein_coding | protein_coding | ENST00000283871 | 14 | 54399 |
pLI Probability LOF Intolerant | pRec Probability LOF Recessive | Individuals with no LOFs | Individuals with Homozygous LOFs | Individuals with Heterozygous LOFs | Defined | p |
---|---|---|---|---|---|---|
2.96e-8 | 0.921 | 125664 | 0 | 82 | 125746 | 0.000326 |
Z-Score | Observed | Expected | Observed/Expected | Mutation Rate | Total Possible in Transcript | |
---|---|---|---|---|---|---|
Missense | 0.290 | 223 | 236 | 0.947 | 0.0000125 | 2948 |
Missense in Polyphen | 99 | 100.66 | 0.98353 | 1220 | ||
Synonymous | -1.86 | 106 | 84.3 | 1.26 | 0.00000463 | 820 |
Loss of Function | 1.81 | 16 | 26.0 | 0.616 | 0.00000129 | 316 |
LoF frequencies by population
Ethnicity | Sum of pLOFs | p |
---|---|---|
African & African-American | 0.000235 | 0.000235 |
Ashkenazi Jewish | 0.00 | 0.00 |
East Asian | 0.000272 | 0.000272 |
Finnish | 0.0000462 | 0.0000462 |
European (Non-Finnish) | 0.000353 | 0.000352 |
Middle Eastern | 0.000272 | 0.000272 |
South Asian | 0.000915 | 0.000915 |
Other | 0.000163 | 0.000163 |
dbNSFP
Source:
- Pathway
- Tyrosine metabolism - Homo sapiens (human);Tyrosinemia, transient, of the newborn;Dopamine beta-hydroxylase deficiency;Disulfiram Action Pathway;Phenylalanine and Tyrosine Metabolism;Tyrosine Metabolism;Alkaptonuria;Monoamine oxidase-a deficiency (MAO-A);Hawkinsinuria;Tyrosinemia Type I;Phenylketonuria;Tyrosinemia Type 3 (TYRO3);Tyrosinemia Type 2 (or Richner-Hanhart syndrome);Histidine, lysine, phenylalanine, tyrosine, proline and tryptophan catabolism;Metabolism of amino acids and derivatives;Phenylalanine and tyrosine catabolism;Metabolism;tyrosine degradation;Tyrosine metabolism
(Consensus)
Recessive Scores
- pRec
- 0.235
Intolerance Scores
- loftool
- 0.273
- rvis_EVS
- -0.38
- rvis_percentile_EVS
- 28.01
Haploinsufficiency Scores
- pHI
- 0.591
- hipred
- N
- hipred_score
- 0.394
- ghis
- 0.549
Essentials
- essential_gene_CRISPR
- N
- essential_gene_CRISPR2
- N
- essential_gene_gene_trap
- N
- gene_indispensability_pred
- E
- gene_indispensability_score
- 0.990
Gene Damage Prediction
All | Recessive | Dominant | |
---|---|---|---|
Mendelian | Medium | Medium | Medium |
Primary Immunodeficiency | Medium | Medium | Medium |
Cancer | Medium | Medium | Medium |
Mouse Genome Informatics
- Gene name
- Hgd
- Phenotype
- immune system phenotype; renal/urinary system phenotype; liver/biliary system phenotype; homeostasis/metabolism phenotype; growth/size/body region phenotype;
Gene ontology
- Biological process
- cellular amino acid metabolic process;L-phenylalanine catabolic process;tyrosine catabolic process;oxidation-reduction process
- Cellular component
- cytosol;extracellular exosome
- Molecular function
- homogentisate 1,2-dioxygenase activity;protein binding;identical protein binding;metal ion binding