ICOS

inducible T cell costimulator, the group of CD molecules

Basic information

Region (hg38): 2:203936762-203961577

Links

ENSG00000163600 ∙ NCBI:29851 ∙ OMIM:604558 ∙ HGNC:5351 ∙ Uniprot:Q9Y6W8 ∙ AlphaFold ∙ GenCC ∙ jax ∙ Sfari ∙ GnomAD ∙ Pubmed ∙ ClinVar

Phenotypes

GenCC

Source: genCC

• immunodeficiency, common variable, 1 (Moderate), mode of inheritance: AR
• common variable immunodeficiency (Supportive), mode of inheritance: AD
• immunodeficiency, common variable, 1 (Strong), mode of inheritance: AR
• common variable immunodeficiency (Definitive), mode of inheritance: AR

Clinical Genomic Database

Source: CGD

Condition	Inheritance	Intervention Categories	Intervention/Rationale	Manifestation Categories	References
Immunodeficiency, common variable, 1	AR	Allergy/Immunology/Infectious	Antiinfectious prophylaxis (including with administration of IVIG) and early and aggressive treatment of infections may be beneficial	Allergy/Immunology/Infectious	12577056; 15507387; 18424338; 19426217; 20301476; 21970952

ClinVar

This is a list of variants' phenotypes submitted to ClinVar and linked to the ICOS gene.

• Immunodeficiency, common variable, 1 (144 variants)
• not provided (24 variants)
• Inborn genetic diseases (5 variants)
• not specified (4 variants)
• Inherited Immunodeficiency Diseases (2 variants)

Variants pathogenicity by type

Statistics on ClinVar variants can assist in determining whether a specific variant type in the ICOS gene is commonly pathogenic or not.

In the table, we include only reliable ClinVar variants with their consequences to MANE Select, Mane Plus Clinical transcripts, or transcripts with TSL equals 1. Click the count to view the source variants.

Warning: slight differences between displayed counts and the number of variants in ClinVar may occur, primarily due to (1) the application of a different transcript and/or consequence by our variant effect predictor or (2) differences in clinical significance: we classify Benign/Likely benign variants as Likely benign and Pathogenic/Likely pathogenic variants as Likely pathogenic.

Variant type	Pathogenic	Likely pathogenic	VUS	Likely benign	Benign	Sum
synonymous			1	24	1	26
missense			37		1	38
nonsense	3					3
start loss						0
frameshift	2	1				3
inframe indel			1			1
splice donor/acceptor (+/-2bp)		2	1			3
splice region			5	2	2	9
non coding			27	13	22	62
Total	5	3	67	37	24

Variants in ICOS

This is a list of pathogenic ClinVar variants found in the ICOS region.

You can filter this list by clicking the number of variants in the Variants pathogenicity by type table.

Position	Type	Phenotype	Significance	ClinVar
2-203936791-G-T		Immunodeficiency, common variable, 1	Uncertain significance (Jan 15, 2018)
2-203936823-A-C		Immunodeficiency, common variable, 1	Likely benign (Sep 30, 2022)
2-203936827-C-T		Immunodeficiency, common variable, 1	Uncertain significance (May 29, 2019)
2-203936831-G-A		Immunodeficiency, common variable, 1	Pathogenic (Jun 08, 2022)
2-203936838-C-A		Immunodeficiency, common variable, 1	Uncertain significance (Jun 10, 2022)
2-203936854-C-T		Immunodeficiency, common variable, 1 • ICOS-related disorder	Benign (Jan 23, 2024)
2-203936855-G-A		Immunodeficiency, common variable, 1	Uncertain significance (Oct 18, 2022)
2-203936856-C-A		Immunodeficiency, common variable, 1	Conflicting classifications of pathogenicity (Jul 06, 2023)
2-203936857-A-G		Immunodeficiency, common variable, 1	Uncertain significance (Jul 10, 2022)
2-203936859-T-G		Immunodeficiency, common variable, 1	Uncertain significance (Aug 09, 2022)
2-203936873-G-A		Immunodeficiency, common variable, 1 • Inherited Immunodeficiency Diseases	Likely pathogenic (Jan 01, 2019)
2-203936876-A-C		Immunodeficiency, common variable, 1	Uncertain significance (Nov 16, 2021)
2-203936881-T-G		Immunodeficiency, common variable, 1	Conflicting classifications of pathogenicity (Jan 29, 2024)
2-203936885-T-C		Immunodeficiency, common variable, 1	Likely benign (Dec 04, 2022)
2-203936892-T-G		Immunodeficiency, common variable, 1	Likely benign (Dec 10, 2022)
2-203937045-T-C			Benign (Jun 20, 2021)
2-203955028-TTCTTGTCAGAGTAGTTTGATCAACAGGTAGACAATTCCTTCTCCCCAAGATATACCTACTAATAAATGAAGTTTTTCCTAAACTTCAACTTTTCCCATATCTCTCTGTTTAGCTAAGTGCTACTAATCCTTTAATTCCAATTTTAAAACTCACTTCCTCAAGGCGGCATTTTCTGATTCTATAATCAAAATTATAACCCACCTGACTCTACCACCTTCATTTAAATAGTACTCCATTCCTATCACAAATTATGTTGCATTACTACATATTTATTCCTTTACCATCTGCCTCCAATATGAAAGCTACCAAAGGACAGAGGCCATACCAGTTTGATTCATACACACTATGTAAATATATTATTTAATATTTAGTATATTCTATATTCACATATGACAAGCAAGTTTCTGGTTAGGATTTTTTTTTCTCTAGGACATAGTTTTATCTTATGTTCTTCCTTGAGGGGTGGAGGGAGAATGTGAAGCTGTTTCATTTTGGTGCAACAGAGATGACTTTATGCATTGAATAAATTGCTTTTATGTTAAAATATAATTATTAGGGCAACATTATAAAATGTCACTTTTGCTTTGTTTTCTTTCTTTTTATGCAGGAGAAATCAATGGTTCTGCCAATTATGAGATGTTTATATTTCACAACGGAGGTGTACAAATTTTATGCAAATATCCTGACATTGTCCAGCAATTTAAAATGCAGTTGCTGAAAGGGGGGCAAATACTCTGCGATCTCACTAAGACAAAAGGAAGTGGAAACACAGTGTCCATTAAGAGTCTGAAATTCTGCCATTCTCAGTTATCCAACAACAGTGTCTCTTTTTTTCTATACAACTTGGACCATTCTCATGCCAACTATTACTTCTGCAACCTATCAATTTTTGATCCTCCTCCTTTTAAAGTAACTCTTACAGGAGGATATTTGCATATTTATGGTAAGACATTGCTTTCATCTTCCAAACTTAAGAGTATATATATGTTTTGACAACTTTTCTCACTAATAAAATCAATTAGACAAATAAATATCTTTTGTGTTGGAGTTCACTTAGATGCAGTTGATGGTAATCATTTATAATGAAGATATACAGGTGATGATTTACTATTAATCATAATTAGTATTATTCAGCAATATGCAATGTAATCCCATAGACTGCTAAGTCAGAAATAGATCATATTGCCTTTTAAACACATATGCTATTAAAAATCAGGAAAAACATTAAGACAAATACTTAAACTTATGGCTTAATAATGGGTATTATCTCTATTCACCTAAGATTTAAGGTTTGGTTTTGCACTGTGTTTGTGGAATGAAGTATGATGATTGAAAATCATAGTTTTATAACATTACTTTTACTATTACCTCTTTTATAAAAATATAGGCAGAAAAGCCCTTTCTATTAACCACATTTGTAAATACATTATATGCATAATCTTTTAAGTTTTAGTTCCTGGATCCTTGCCATAATACTGAGATGATGTTAGTCTAATAACTTGCCCACTTACTGGATTTCATGACTATAATAAAGAAAAGCTTCATTTGATTAAATAGCTCTTTTAAATTTGGTAAGAGAACTTGTGGTTCAGCAGAATTTTTCATTAACATACCTTTTTTTCCAATCCAGAATCACAACTTTGTTGCCAGCTGAAGTTCTGGTTACCCATAGGATGTGCAGCCTTTGTTGTAGTCTGCATTTTGGGATGCATACTTATTTGTTGGCTTACAAAAAAGGTAAGCGATTTCTATCTTTCCTTGTATCTGCTTTACAGATGCACATCAGTGATTATTTCCTCATCAAAAGTACACATGGC-T		Immunodeficiency, common variable, 1	Pathogenic (Dec 01, 2004)
2-203955620-C-A		Immunodeficiency, common variable, 1	Likely benign (May 08, 2023)
2-203955629-T-C		Immunodeficiency, common variable, 1	Likely benign (Nov 04, 2023)
2-203955633-C-T		Immunodeficiency, common variable, 1	Uncertain significance (Jan 01, 2023)
2-203955638-G-T		Immunodeficiency, common variable, 1	Pathogenic (May 08, 2023)
2-203955648-G-T		Immunodeficiency, common variable, 1 • Inborn genetic diseases	Uncertain significance (Nov 21, 2022)
2-203955654-C-A		Immunodeficiency, common variable, 1	Uncertain significance (Sep 15, 2021)
2-203955662-G-A		Immunodeficiency, common variable, 1	Uncertain significance (Dec 18, 2021)
2-203955670-T-C		Immunodeficiency, common variable, 1	Likely benign (Jan 25, 2024)

GnomAD

Source: gnomAD

Gene	Type	Bio Type	Transcript	Coding Exons	Length
ICOS	protein_coding	protein_coding	ENST00000316386	5	24830

pLI Probability LOF Intolerant	pRec Probability LOF Recessive	Individuals with no LOFs	Individuals with Homozygous LOFs	Individuals with Heterozygous LOFs	Defined	p
0.0313	0.930	125729	0	2	125731	0.00000795

	Z-Score	Observed	Expected	Observed/Expected	Mutation Rate	Total Possible in Transcript
Missense	1.21	69	104	0.666	0.00000478	1310
Missense in Polyphen		17	28.154	0.60381		392
Synonymous	-0.552	41	36.7	1.12	0.00000196	357
Loss of Function	1.78	4	10.1	0.395	4.25e-7	136

LoF frequencies by population

Ethnicity	Sum of pLOFs	p
African & African-American	0.0000289	0.0000289
Ashkenazi Jewish	0.00	0.00
East Asian	0.00	0.00
Finnish	0.00	0.00
European (Non-Finnish)	0.00000880	0.00000879
Middle Eastern	0.00	0.00
South Asian	0.00	0.00
Other	0.00	0.00

dbNSFP

Source: dbNSFP

• Function: FUNCTION: Enhances all basic T-cell responses to a foreign antigen, namely proliferation, secretion of lymphokines, up- regulation of molecules that mediate cell-cell interaction, and effective help for antibody secretion by B-cells. Essential both for efficient interaction between T and B-cells and for normal antibody responses to T-cell dependent antigens. Does not up- regulate the production of interleukin-2, but superinduces the synthesis of interleukin-10. Prevents the apoptosis of pre- activated T-cells. Plays a critical role in CD40-mediated class switching of immunoglobin isotypes (By similarity). {ECO:0000250, ECO:0000269|PubMed:11169414, ECO:0000269|PubMed:9930702}.
• Disease: DISEASE: Immunodeficiency, common variable, 1 (CVID1) [MIM:607594]: A primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low. {ECO:0000269|PubMed:12577056}. Note=The disease is caused by mutations affecting the gene represented in this entry.
• Pathway: Primary immunodeficiency - Homo sapiens (human);Cell adhesion molecules (CAMs) - Homo sapiens (human);T cell receptor signaling pathway - Homo sapiens (human);Intestinal immune network for IgA production - Homo sapiens (human);T-Cell antigen Receptor (TCR) pathway during Staphylococcus aureus infection;T-Cell antigen Receptor (TCR) Signaling Pathway;Disease;Signal Transduction;the co-stimulatory signal during t-cell activation;Costimulation by the CD28 family;TCR;Immune System;Adaptive Immune System;PIP3 activates AKT signaling;PI5P, PP2A and IER3 Regulate PI3K/AKT Signaling;Negative regulation of the PI3K/AKT network;Constitutive Signaling by Aberrant PI3K in Cancer;PI3K/AKT Signaling in Cancer;Intracellular signaling by second messengers;Diseases of signal transduction (Consensus)

Recessive Scores

• pRec: 0.268

Intolerance Scores

• loftool: 0.428
• rvis_EVS: 0.26
• rvis_percentile_EVS: 70.06

Haploinsufficiency Scores

• pHI: 0.0714
• hipred: N
• hipred_score: 0.123

Essentials

• essential_gene_CRISPR: N
• essential_gene_CRISPR2: N
• essential_gene_gene_trap: N
• gene_indispensability_pred: E
• gene_indispensability_score: 0.660

Gene Damage Prediction

	All	Recessive	Dominant
Mendelian	Medium	Medium	Medium
Primary Immunodeficiency	Medium	Medium	Medium
Cancer	Medium	Medium	Medium

Mouse Genome Informatics

• Gene name: Icos
• Phenotype: immune system phenotype; digestive/alimentary phenotype; hematopoietic system phenotype; neoplasm; homeostasis/metabolism phenotype; endocrine/exocrine gland phenotype

Gene ontology

• Biological process: T cell tolerance induction;immune response;T cell costimulation;phosphatidylinositol phosphorylation;positive regulation of protein kinase B signaling;cell-cell adhesion
• Cellular component: extracellular region;plasma membrane;integral component of plasma membrane;external side of plasma membrane
• Molecular function: protein binding;phosphatidylinositol-4,5-bisphosphate 3-kinase activity